Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCAG-Bmp2 Resource Report Resource Website |
RRID:Addgene_163587 | Bmp2 | Mus musculus | Ampicillin | PMID:34161760 | Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:47 | 0 | ||
|
pEGFP-N1-mSNX27 RNAi-resistant Resource Report Resource Website |
RRID:Addgene_163620 | mouse SNX27 RNAi-resistant | Mus musculus | Kanamycin | PMID:31775031 | fw primer RNAi resistant rat: GGGCAGCTGGAGAACCAAGTGATCGCATTCGAATGGGATGAGATGC | Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | RNAi resistance | 2026-07-25 12:41:48 | 0 |
|
pCAG-Bmp5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_163589 | Bmp5 | Mus musculus | Ampicillin | PMID:34161760 | Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:47 | 1 | ||
|
pBS-TRE-cofilin1(S3A)-P2A-mTurquoise2 Resource Report Resource Website |
RRID:Addgene_163610 | cofilin1 | Mus musculus | Ampicillin | PMID:34161760 | Vector Backbone:pBluescript SK(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:47 | 0 | ||
|
pEGFP-N1-mSNX27-H112A Resource Report Resource Website 1+ mentions |
RRID:Addgene_163619 | mouse SNX27-H112A | Mus musculus | Kanamycin | PMID:31775031 | Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | H112A | 2026-07-25 12:41:47 | 1 | |
|
pCAG-Bmp15 Resource Report Resource Website |
RRID:Addgene_163594 | Bmp15 | Mus musculus | Ampicillin | PMID:34161760 | Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:47 | 0 | ||
|
pCAG-Gdf7 Resource Report Resource Website |
RRID:Addgene_163597 | Gdf7 | Mus musculus | Ampicillin | PMID:34161760 | Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Some Guanin and Cytosine were substituted to reduce the GC ratio | 2026-07-25 12:41:47 | 0 | |
|
pCAG-Gdf6 Resource Report Resource Website |
RRID:Addgene_163598 | Gdf6 | Mus musculus | Ampicillin | PMID:34161760 | Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:47 | 0 | ||
|
pCAG-Bmp7 Resource Report Resource Website |
RRID:Addgene_163591 | Bmp7 | Mus musculus | Ampicillin | PMID:34161760 | Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:47 | 0 | ||
|
pCAG-Bmp6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_163590 | Bmp6 | Mus musculus | Ampicillin | PMID:34161760 | Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:47 | 1 | ||
|
pAAV-CAG-GFP-mirMecp2 Resource Report Resource Website |
RRID:Addgene_163704 | mirMecp2 and EGFP | Mus musculus | Ampicillin | PMID:33046553 | Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:48 | 0 | ||
|
pAAV hSynapsin SV-tag Resource Report Resource Website |
RRID:Addgene_163685 | synatophysin 9X HA tag T2A tdtomato | Mus musculus | Ampicillin | PMID:33043885 | Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:48 | 0 | ||
|
pYX233-DHFR Resource Report Resource Website 1+ mentions |
RRID:Addgene_163761 | DHFR | Mus musculus | Ampicillin | PMID:30886345 | Backbone Size:7400; Vector Backbone:pYX233; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:49 | 1 | ||
|
pYX233-b2-DHFR Resource Report Resource Website 1+ mentions |
RRID:Addgene_163759 | b2-DHFR | Mus musculus | Ampicillin | PMID:30886345 | Backbone Size:7400; Vector Backbone:pYX233; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Amino acids 1-167 of S.c. Cytochrome b2 (Cyb2) fused to mouse DHFR | 2026-07-25 12:41:49 | 1 | |
|
ADAP1 Resource Report Resource Website |
RRID:Addgene_163905 | ADAP1 | Mus musculus | Ampicillin | PMID:33443153 | Backbone Marker:thermo fisher (Invitrogen); Backbone Size:4807; Vector Backbone:pFastBac HTb; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:50 | 0 | ||
|
pFlox_N-Mau2_Neo_FKBPF36V_mScarlet Resource Report Resource Website |
RRID:Addgene_163881 | Mau2 | Mus musculus | Ampicillin | PMID:33334824 | Vector Backbone:pflox; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:50 | 0 | ||
|
pFlox_N-Mau2_BSD_FKBPF36V_EYFP Resource Report Resource Website |
RRID:Addgene_163880 | Mau2 | Mus musculus | Ampicillin | PMID:33334824 | Vector Backbone:pflox; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:50 | 0 | ||
|
pFlox_N-Nipbl_Neo_FKBPF36V_mScarlet Resource Report Resource Website |
RRID:Addgene_163883 | Nipbl | Mus musculus | Ampicillin | PMID:33334824 | Vector Backbone:pflox; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:50 | 0 | ||
|
pFlox_N-Nipbl_BSD_FKBPF36V_EYFP Resource Report Resource Website |
RRID:Addgene_163882 | Nipbl | Mus musculus | Ampicillin | PMID:33334824 | Vector Backbone:pflox; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:50 | 0 | ||
|
pFlox_N-RPB1_BSD_FKBPF36V_EYFP Resource Report Resource Website |
RRID:Addgene_163884 | Rbp1 | Mus musculus | Ampicillin | PMID:33334824 | Vector Backbone:pflox; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:41:50 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
