Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: 2.1 kB VEGF
Vector Backbone Description: Backbone Size:5598; Vector Backbone:PGL2 Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15582599
Proper citation: RRID:Addgene_27988 Copy
Species: Mus musculus
Genetic Insert: VEGF
Vector Backbone Description: Backbone Size:5598; Vector Backbone:PGL2 Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15582599
Proper citation: RRID:Addgene_27986 Copy
Species: Mus musculus
Genetic Insert: TNFalpha
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17606866
Proper citation: RRID:Addgene_28089 Copy
Species: Mus musculus
Genetic Insert: PTEN 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5010; Vector Backbone:pGL3-Promoter; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20103531
Comments: Note that Addgene's sequencing result contains a 3 nucleotide deletion (bp# 7639-7641) when compared with GenBank accession number NM_008960.2
PTEN 3'UTR was amplified from Balb/c mouse genomic DNA with the following primer pairs:
F: 5' GCTAGCCCCCCTCCTTG
R: 5' GCTAGCAAAAATAATGAACCTTTTTAATTGTTTAAAGG
PCR products were digested with NheI and subcloned into the XbaI site of the pGL3-promoter vector (Promega)
Proper citation: RRID:Addgene_28104 Copy
Species: Mus musculus
Genetic Insert: Nr5a1 shRNA
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:6478; Vector Backbone:pRNAT-CMV3.1/Neo; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18388192
Comments: shRNA#2 sequence:
GATCCTAGAGGTAGCCAGCCAGAGGTTTGATATCCGACCTCTGGCTGGCTACCTCTACGC
Proper citation: RRID:Addgene_28187 Copy
Species: Mus musculus
Genetic Insert: SF-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12239114
Comments: This plasmid contains 1601 bp of SF-1 derived cDNA and an additional 10 bp from the AT cloning vector pCR2.1.
Proper citation: RRID:Addgene_28185 Copy
Species: Mus musculus
Genetic Insert: Nr5a1 shRNA
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:6478; Vector Backbone:pRNAT-CMV3.1/Neo; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18388192
Comments: shRNA #1 sequence: GATCCTAATGCTTGTTGTTCTGGACTTTGATATCCGAGTCCAGAACAACAAGCATTACGC
Proper citation: RRID:Addgene_28186 Copy
Species: Mus musculus
Genetic Insert: SF1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1-his; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10770490
Comments: The His-tagged-SF1 (antisense) plasmid, the plasmid was created as a control for the His-tagged-SF1 plasmid (#28182). The SF1 insert was placed in the 3' - 5' orientation downstream of the His tag. As such, the transcript will not encode an open reading frame.
Proper citation: RRID:Addgene_28183 Copy
Species: Mus musculus
Genetic Insert: SF-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12239114
Comments: This plasmid contains 1601 bp of SF-1 derived cDNA and an additional 10 bp from the AT cloning vector pCR2.1.
Proper citation: RRID:Addgene_28181 Copy
Species: Mus musculus
Genetic Insert: SF1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1-his; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10770490
Proper citation: RRID:Addgene_28182 Copy
Species: Mus musculus
Genetic Insert: SF-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12239114
Comments: This plasmid contains 1601 bp of SF-1 derived cDNA and an additional 10 bp from the AT cloning vector pCR2.1.
Proper citation: RRID:Addgene_28180 Copy
Species: Mus musculus
Genetic Insert: Prkar1a
Vector Backbone Description: Backbone Size:7600; Vector Backbone:pMT-REV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8388994
Comments: Expression vector encoding dominant-negative regulatory subunit of type 1 cAMP-dependent protein kinase.
pMT-REV is a zinc-inducible expression vector driven by the metallothionein promoter.
Proper citation: RRID:Addgene_28178 Copy
Species: Mus musculus
Genetic Insert: Lrh-1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20734354
Proper citation: RRID:Addgene_28093 Copy
Species: Mus musculus
Genetic Insert: Lrh-1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pEF1a-Luc-IRES-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20734354
Proper citation: RRID:Addgene_28092 Copy
Species: Mus musculus
Genetic Insert: Net1A
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEF-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19586902
Proper citation: RRID:Addgene_28262 Copy
Species: Mus musculus
Genetic Insert: Net1
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEF-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19586902
Proper citation: RRID:Addgene_28263 Copy
Species: Mus musculus
Genetic Insert: Net1A
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5006; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19586902
Proper citation: RRID:Addgene_28261 Copy
Species: Mus musculus
Genetic Insert: Slc9c1
Vector Backbone Description: Vector Backbone:pCAG1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41091759
Proper citation: RRID:Addgene_249414 Copy
Species: Mus musculus
Genetic Insert: aCatenin tension indicator
Vector Backbone Description: Vector Backbone:pEGFP-N1 derived backbone (Kan/Neo); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41714452
Proper citation: RRID:Addgene_252386 Copy
Species: Mus musculus
Genetic Insert: Trac & Trbc1(variant)
Vector Backbone Description: Backbone Marker:custom; Backbone Size:1710; Vector Backbone:pmakeTCR; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://doi.org/10.1101/2025.04.27.647198 for bioRxiv preprint.
Proper citation: RRID:Addgene_233948 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
