Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: tRNALys
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Cloned using pAla57 as the vector
Proper citation: RRID:Addgene_211564 Copy
Species: Synthetic
Genetic Insert: LLhPtxS
Vector Backbone Description: Backbone Marker:Jonathan Kuhn (Stewart et al. 1986 PMID: 3012611); Vector Backbone:pHG165a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_220271 Copy
Species: Mus musculus
Genetic Insert: Vgf-T2A-mCherry
Vector Backbone Description: Backbone Size:4093; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40307547
Comments: Please visit https://doi.org/10.1101/2023.02.03.527010 for bioRxiv preprint.
Proper citation: RRID:Addgene_223661 Copy
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:4082; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40307547
Comments: Please visit https://doi.org/10.1101/2023.02.03.527010 for bioRxiv preprint.
Proper citation: RRID:Addgene_223662 Copy
Species: Synthetic
Genetic Insert: LLhRafR
Vector Backbone Description: Backbone Marker:Jonathan Kuhn (Stewart et al. 1986 PMID: 3012611); Vector Backbone:pHG165a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_220273 Copy
Species: Synthetic
Genetic Insert: LLhRafR
Vector Backbone Description: Backbone Marker:Jonathan Kuhn (Stewart et al. 1986 PMID: 3012611); Vector Backbone:pHG165a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_220274 Copy
Species: Homo sapiens
Genetic Insert: hM3D(Gq)-mCherry and shLacZ
Vector Backbone Description: Backbone Marker:Beatriz Rico; Backbone Size:4290; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40307547
Comments: Please visit https://doi.org/10.1101/2023.02.03.527010 for bioRxiv preprint.
Proper citation: RRID:Addgene_223660 Copy
Species: Mus musculus
Genetic Insert: CARGO to 36kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227462 Copy
Species: Homo sapiens
Genetic Insert: HaloTag followed by a PolyA signal and PuroR cassette flanked by human REV7 locus sequences
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207079 Copy
Species: Mus musculus
Genetic Insert: CARGO to 36kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227463 Copy
Species: Mus musculus
Genetic Insert: CARGO to 29kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227466 Copy
Species: Synthetic
Genetic Insert: LLhScrR
Vector Backbone Description: Backbone Marker:Jonathan Kuhn (Stewart et al. 1986 PMID: 3012611); Vector Backbone:pHG165a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_220277 Copy
Species: Mus musculus
Genetic Insert: CARGO to 26kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227467 Copy
Species: Mus musculus
Genetic Insert: CARGO to 25kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227468 Copy
Species: Synthetic
Genetic Insert: tRNASer
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Cloned using pAla57 as the vector
Proper citation: RRID:Addgene_211570 Copy
Species: Mus musculus
Genetic Insert: CARGO to 14kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227470 Copy
Species: Synthetic
Genetic Insert: Type 3-4 E2-Crimson cassette
Vector Backbone Description: Backbone Size:1847; Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:37786689
Comments: Please visit https://doi.org/10.1101/2023.09.19.558440 for bioRxiv preprint.
Proper citation: RRID:Addgene_209543 Copy
Species: Homo sapiens
Genetic Insert: AATACTAAATAGAATTTTCA
Vector Backbone Description: Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207096 Copy
Species: Homo sapiens
Genetic Insert: HaloTag with internal PuroR cassette flanked by human ATG16L1 locus sequences
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37115157
Proper citation: RRID:Addgene_207537 Copy
Species: Homo sapiens
Genetic Insert: AVPR1B
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34163676
Proper citation: RRID:Addgene_208925 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
