Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pk335-CARGO-6mer-58kb-USF Resource Report Resource Website |
RRID:Addgene_227457 | CARGO to 58kb Upstream Fgf5 | Mus musculus | Kanamycin | PMID:39626660 | Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-09-12 02:43:35 | 0 | ||
|
pk335-CARGO-6mer-40kb-USF Resource Report Resource Website |
RRID:Addgene_227460 | CARGO to 40kb Upstream Fgf5 | Mus musculus | Kanamycin | PMID:39626660 | Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-09-12 02:43:35 | 0 | ||
|
pLD-puro-Cc-IFIT5_K206R-VA Resource Report Resource Website |
RRID:Addgene_191224 | interferon-induced protein with tetratricopeptide repeats 5 | Homo sapiens | Ampicillin | PMID:40593736 | Addgene's NGS results found a 51 bp insertion in the IFIT5 insert ORF that does not affect plasmid function. | Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | changed Lysine 206 to Arginine (K206R) | 2026-09-12 02:43:34 | 0 |
|
pLD-puro-Cc-IFIT5_WT-VA Resource Report Resource Website |
RRID:Addgene_191221 | interferon-induced protein with tetratricopeptide repeats 5 | Homo sapiens | Ampicillin | PMID:40593736 | Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-12 02:43:34 | 0 | ||
|
pk335-CARGO-6mer-24kb-USP Resource Report Resource Website |
RRID:Addgene_227445 | CARGO to 24kb Upstream Prdm8 | Mus musculus | Kanamycin | PMID:39626660 | Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-09-12 02:43:35 | 0 | ||
|
pk335-CARGO-6mer-20kb-USP Resource Report Resource Website |
RRID:Addgene_227446 | CARGO to 20kb Upstream Prdm8 | Mus musculus | Kanamycin | PMID:39626660 | Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-09-12 02:43:35 | 0 | ||
|
HaloKu70 sgRNA Resource Report Resource Website |
RRID:Addgene_207583 | GAGCAGTAGCCAACATGTCA | Homo sapiens | Ampicillin | PMID:39578493 | Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:43:34 | 0 | ||
|
pLEX_307-SARS-CoV-2-NSP3-V5 Resource Report Resource Website |
RRID:Addgene_214429 | SARS-CoV-2 NSP3 (part of SARS-CoV-2 ORF1ab) | Other | Ampicillin | PMID:40593736 | Backbone Marker:David Root lab; Backbone Size:10065; Vector Backbone:pLEX_307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-12 02:43:34 | 0 | ||
|
pLD-puro-Cc-SARS-CoV-2_Spike_Lambda-VA Resource Report Resource Website |
RRID:Addgene_191220 | SPIKE_SARS2_Lambda | SARS CoV-2 | Ampicillin | PMID:40593736 | Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | G75V T76I Del 246-252 L452Q F490S D614G T859N | 2026-09-12 02:43:34 | 0 | |
|
RNF168 C-terminal sgRNA Resource Report Resource Website |
RRID:Addgene_207100 | GAGATGCACAAAGTAAGGCC | Homo sapiens | Ampicillin | PMID:37341699 | Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:43:34 | 0 | ||
|
pk335-CARGO-6mer-3.3kb-USF Resource Report Resource Website |
RRID:Addgene_227475 | CARGO to 3.3kb Upstream Fgf5 | Mus musculus | Kanamycin | PMID:39626660 | Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-09-12 02:43:35 | 0 | ||
|
pk335-CARGO-6mer-1.9kb-USF Resource Report Resource Website |
RRID:Addgene_227476 | CARGO to 1.9kb Upstream Fgf5 | Mus musculus | Kanamycin | PMID:39626660 | Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-09-12 02:43:35 | 0 | ||
|
pk335-CARGO-6mer-2.4kb-USF Resource Report Resource Website |
RRID:Addgene_227477 | CARGO to 2.4kb Upstream Fgf5 | Mus musculus | Kanamycin | PMID:39626660 | Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-09-12 02:43:35 | 0 | ||
|
pHis57 Resource Report Resource Website |
RRID:Addgene_211562 | tRNAHis | Synthetic | Ampicillin | Cloned using pAla57 as the vector | Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:43:34 | 0 | ||
|
pGly57 Resource Report Resource Website |
RRID:Addgene_211561 | tRNAGly | Synthetic | Ampicillin | Cloned using pAla57 as the vector | Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:43:34 | 0 | ||
|
pk335-CARGO-5mer-Fgf5Pro Resource Report Resource Website |
RRID:Addgene_227480 | CARGO to Fgf5 promoter | Mus musculus | Kanamycin | PMID:39626660 | Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-09-12 02:43:35 | 0 | ||
|
pPro57 Resource Report Resource Website |
RRID:Addgene_211569 | tRNAPro | Synthetic | Ampicillin | Cloned using pAla57 as the vector | Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:43:34 | 0 | ||
|
pPhe57 Resource Report Resource Website |
RRID:Addgene_211568 | tRNAPhe | Synthetic | Ampicillin | Cloned using pAla57 as the vector | Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:43:34 | 0 | ||
|
pLys57-4 Resource Report Resource Website |
RRID:Addgene_211567 | tRNALys | Synthetic | Ampicillin | Synthesized | Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:43:34 | 0 | ||
|
pLys57-3 Resource Report Resource Website |
RRID:Addgene_211566 | tRNALys | Synthetic | Ampicillin | Synthesized | Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:43:34 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.