Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

742,581 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pk335-CARGO-6mer-58kb-USF
 
Resource Report
Resource Website
RRID:Addgene_227457 CARGO to 58kb Upstream Fgf5 Mus musculus Kanamycin PMID:39626660 Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:43:35 0
pk335-CARGO-6mer-40kb-USF
 
Resource Report
Resource Website
RRID:Addgene_227460 CARGO to 40kb Upstream Fgf5 Mus musculus Kanamycin PMID:39626660 Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:43:35 0
pLD-puro-Cc-IFIT5_K206R-VA
 
Resource Report
Resource Website
RRID:Addgene_191224 interferon-induced protein with tetratricopeptide repeats 5 Homo sapiens Ampicillin PMID:40593736 Addgene's NGS results found a 51 bp insertion in the IFIT5 insert ORF that does not affect plasmid function. Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin changed Lysine 206 to Arginine (K206R) 2026-09-12 02:43:34 0
pLD-puro-Cc-IFIT5_WT-VA
 
Resource Report
Resource Website
RRID:Addgene_191221 interferon-induced protein with tetratricopeptide repeats 5 Homo sapiens Ampicillin PMID:40593736 Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0
pk335-CARGO-6mer-24kb-USP
 
Resource Report
Resource Website
RRID:Addgene_227445 CARGO to 24kb Upstream Prdm8 Mus musculus Kanamycin PMID:39626660 Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:43:35 0
pk335-CARGO-6mer-20kb-USP
 
Resource Report
Resource Website
RRID:Addgene_227446 CARGO to 20kb Upstream Prdm8 Mus musculus Kanamycin PMID:39626660 Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:43:35 0
HaloKu70 sgRNA
 
Resource Report
Resource Website
RRID:Addgene_207583 GAGCAGTAGCCAACATGTCA Homo sapiens Ampicillin PMID:39578493 Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0
pLEX_307-SARS-CoV-2-NSP3-V5
 
Resource Report
Resource Website
RRID:Addgene_214429 SARS-CoV-2 NSP3 (part of SARS-CoV-2 ORF1ab) Other Ampicillin PMID:40593736 Backbone Marker:David Root lab; Backbone Size:10065; Vector Backbone:pLEX_307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0
pLD-puro-Cc-SARS-CoV-2_Spike_Lambda-VA
 
Resource Report
Resource Website
RRID:Addgene_191220 SPIKE_SARS2_Lambda SARS CoV-2 Ampicillin PMID:40593736 Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin G75V T76I Del 246-252 L452Q F490S D614G T859N 2026-09-12 02:43:34 0
RNF168 C-terminal sgRNA
 
Resource Report
Resource Website
RRID:Addgene_207100 GAGATGCACAAAGTAAGGCC Homo sapiens Ampicillin PMID:37341699 Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0
pk335-CARGO-6mer-3.3kb-USF
 
Resource Report
Resource Website
RRID:Addgene_227475 CARGO to 3.3kb Upstream Fgf5 Mus musculus Kanamycin PMID:39626660 Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:43:35 0
pk335-CARGO-6mer-1.9kb-USF
 
Resource Report
Resource Website
RRID:Addgene_227476 CARGO to 1.9kb Upstream Fgf5 Mus musculus Kanamycin PMID:39626660 Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:43:35 0
pk335-CARGO-6mer-2.4kb-USF
 
Resource Report
Resource Website
RRID:Addgene_227477 CARGO to 2.4kb Upstream Fgf5 Mus musculus Kanamycin PMID:39626660 Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:43:35 0
pHis57
 
Resource Report
Resource Website
RRID:Addgene_211562 tRNAHis Synthetic Ampicillin Cloned using pAla57 as the vector Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0
pGly57
 
Resource Report
Resource Website
RRID:Addgene_211561 tRNAGly Synthetic Ampicillin Cloned using pAla57 as the vector Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0
pk335-CARGO-5mer-Fgf5Pro
 
Resource Report
Resource Website
RRID:Addgene_227480 CARGO to Fgf5 promoter Mus musculus Kanamycin PMID:39626660 Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:43:35 0
pPro57
 
Resource Report
Resource Website
RRID:Addgene_211569 tRNAPro Synthetic Ampicillin Cloned using pAla57 as the vector Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0
pPhe57
 
Resource Report
Resource Website
RRID:Addgene_211568 tRNAPhe Synthetic Ampicillin Cloned using pAla57 as the vector Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0
pLys57-4
 
Resource Report
Resource Website
RRID:Addgene_211567 tRNALys Synthetic Ampicillin Synthesized Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0
pLys57-3
 
Resource Report
Resource Website
RRID:Addgene_211566 tRNALys Synthetic Ampicillin Synthesized Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.