Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: CARGO to 58kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227457 Copy
Species: Mus musculus
Genetic Insert: CARGO to 40kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227460 Copy
Species: Homo sapiens
Genetic Insert: interferon-induced protein with tetratricopeptide repeats 5
Vector Backbone Description: Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40593736
Comments: Addgene's NGS results found a 51 bp insertion in the IFIT5 insert ORF that does not affect plasmid function.
Proper citation: RRID:Addgene_191224 Copy
Species: Homo sapiens
Genetic Insert: interferon-induced protein with tetratricopeptide repeats 5
Vector Backbone Description: Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40593736
Proper citation: RRID:Addgene_191221 Copy
Species: Mus musculus
Genetic Insert: CARGO to 24kb Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227445 Copy
Species: Mus musculus
Genetic Insert: CARGO to 20kb Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227446 Copy
Species: Homo sapiens
Genetic Insert: GAGCAGTAGCCAACATGTCA
Vector Backbone Description: Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39578493
Proper citation: RRID:Addgene_207583 Copy
Species: Other
Genetic Insert: SARS-CoV-2 NSP3 (part of SARS-CoV-2 ORF1ab)
Vector Backbone Description: Backbone Marker:David Root lab; Backbone Size:10065; Vector Backbone:pLEX_307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40593736
Proper citation: RRID:Addgene_214429 Copy
Species: SARS CoV-2
Genetic Insert: SPIKE_SARS2_Lambda
Vector Backbone Description: Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40593736
Proper citation: RRID:Addgene_191220 Copy
Species: Homo sapiens
Genetic Insert: GAGATGCACAAAGTAAGGCC
Vector Backbone Description: Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207100 Copy
Species: Mus musculus
Genetic Insert: CARGO to 3.3kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227475 Copy
Species: Mus musculus
Genetic Insert: CARGO to 1.9kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227476 Copy
Species: Mus musculus
Genetic Insert: CARGO to 2.4kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227477 Copy
Species: Synthetic
Genetic Insert: tRNAHis
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Cloned using pAla57 as the vector
Proper citation: RRID:Addgene_211562 Copy
Species: Synthetic
Genetic Insert: tRNAGly
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Cloned using pAla57 as the vector
Proper citation: RRID:Addgene_211561 Copy
Species: Mus musculus
Genetic Insert: CARGO to Fgf5 promoter
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227480 Copy
Species: Synthetic
Genetic Insert: tRNAPro
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Cloned using pAla57 as the vector
Proper citation: RRID:Addgene_211569 Copy
Species: Synthetic
Genetic Insert: tRNAPhe
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Cloned using pAla57 as the vector
Proper citation: RRID:Addgene_211568 Copy
Species: Synthetic
Genetic Insert: tRNALys
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Synthesized
Proper citation: RRID:Addgene_211567 Copy
Species: Synthetic
Genetic Insert: tRNALys
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Synthesized
Proper citation: RRID:Addgene_211566 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
