Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: RSV
Genetic Insert: RSV B F from 1992 human codon optimized from Genbank Accesion OK649748
Vector Backbone Description: Vector Backbone:HDM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40607811
Comments: Please visit https://doi.org/10.1101/2025.03.11.642476 for bioRxiv preprint.
Proper citation: RRID:Addgene_237358 Copy
Species: Homo sapiens
Genetic Insert: Grx1-roGFP2-Coilin
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_236546 Copy
Species: Homo sapiens
Genetic Insert: ACTL6A
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_004301.4 Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_144855 Copy
Species: Homo sapiens
Genetic Insert: HNF4G
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_004133,ENST00000396423 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_142676 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Flpo recombinase
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38895464
Proper citation: RRID:Addgene_237222 Copy
Species: Homo sapiens
Genetic Insert: RCOR3
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_001136223,ENST00000419091 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_143928 Copy
Species: SARS CoV-2
Genetic Insert: SPIKE_SARS2_Alpha
Vector Backbone Description: Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40593736
Proper citation: RRID:Addgene_191217 Copy
Species: Homo sapiens
Genetic Insert: GTTCTTCCATctgcaaaaaa
Vector Backbone Description: Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39578493
Proper citation: RRID:Addgene_207605 Copy
Species: Homo sapiens
Genetic Insert: TACTGGGTTCAGAAACAAGG
Vector Backbone Description: Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39578493
Proper citation: RRID:Addgene_207606 Copy
Species: Homo sapiens
Genetic Insert: Five repeats of E67R SUMO1 each separated by (GGS)4
Vector Backbone Description: Backbone Size:6600; Vector Backbone:pMAL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262618
Proper citation: RRID:Addgene_221072 Copy
Species: Synthetic
Genetic Insert: LLhAraR
Vector Backbone Description: Backbone Marker:Jonathan Kuhn (Stewart et al. 1986 PMID: 3012611); Vector Backbone:pHG165a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_220268 Copy
Species: Synthetic
Genetic Insert: LLhKdgR
Vector Backbone Description: Backbone Marker:Jonathan Kuhn (Stewart et al. 1986 PMID: 3012611); Vector Backbone:pHG165a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_220269 Copy
Species: Mus musculus
Genetic Insert: CARGO to 2.1kb Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227451 Copy
Species: SARS CoV-2
Genetic Insert: SPIKE_SARS2_Delta
Vector Backbone Description: Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40593736
Proper citation: RRID:Addgene_191219 Copy
Species: Mus musculus
Genetic Insert: CARGO to 700bp Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227452 Copy
Species: Homo sapiens
Genetic Insert: vTRAP-T2A-hM3D(Gq)
Vector Backbone Description: Backbone Size:4977; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40307547
Comments: Please visit https://doi.org/10.1101/2023.02.03.527010 for bioRxiv preprint.
Proper citation: RRID:Addgene_223654 Copy
Species: Mus musculus
Genetic Insert: CARGO to Prdm8 promoter Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227454 Copy
Species: Mus musculus
Genetic Insert: CARGO to Prdm8 promoter Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227455 Copy
Species: Mus musculus
Genetic Insert: CARGO to Prdm8 promoter Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227456 Copy
Species: Mus musculus
Genetic Insert: CARGO to 58kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660
Proper citation: RRID:Addgene_227457 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.