Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: pAAV hSyn FLEX iGluSnFR3 v857.GPI
Vector Backbone Description: Backbone Size:4836; Vector Backbone:pAAV hSyn FLEX; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_175181 Copy
Species: Mus musculus
Genetic Insert: Pax7
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBRIT-LoxP-HA/FLAG-puro; Vector Types:Mammalian Expression, Retroviral, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_17522 Copy
Species: Mus musculus
Genetic Insert: Myorg
Vector Backbone Description: Backbone Marker:Tom Misteli (Addgene plasmid # 22661); Vector Backbone:pCDHblast-MCSNard OST-LMNA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: predicted catalytic site inactivating mutation
Proper citation: RRID:Addgene_175172 Copy
Species: Mus musculus
Genetic Insert: anti-FLAG M2 heavy chain
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_175359 Copy
Species: Mus musculus
Genetic Insert: Foxo1 AAA
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Plasmid contains polymorphisms K219R and L619P, which are not thought to affect plasmid function.
Proper citation: RRID:Addgene_17547 Copy
Species: Mus musculus
Genetic Insert: pEGFP-N1 Foxo1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Has polymorphism L619P
Proper citation: RRID:Addgene_17551 Copy
Species: Mus musculus
Genetic Insert: Foxo1 6KR
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Plasmid contains K219R and L619P polymorphisms.
Proper citation: RRID:Addgene_17558 Copy
Species: Mus musculus
Genetic Insert: Single chain Fv CD44 antibody (H90)
Vector Backbone Description: Vector Backbone:pNIC-CTH0; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: Ligation-independent cloning 5' site TTAAGAAGGAGATATACTATG ; 3' site GATTGGAAGTAGAGGTTCTCTGC. Gileadi lab uses DH10-Bac or SF9 cells for expression.
Proper citation: RRID:Addgene_175493 Copy
Species: Mus musculus
Genetic Insert: spCas9-nickase and sgRNA against mouse WAPL STOP Codon
Vector Backbone Description: Backbone Marker:Addgene 42335; Vector Backbone:pX335; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_175551 Copy
Species: Mus musculus
Genetic Insert: Vps50
Vector Backbone Description: Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_175500 Copy
Species: Mus musculus
Genetic Insert: Foxo1 6KQ
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Plasmid has K219R and L619P polymorphisms which are not thought to affect plasmid function.
Proper citation: RRID:Addgene_17562 Copy
Species: Mus musculus
Genetic Insert: CD45 gRNA
Vector Backbone Description: Backbone Size:7099; Vector Backbone:pSIN; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_175943 Copy
Species: Mus musculus
Genetic Insert: CKAP2
Vector Backbone Description: Backbone Marker:Peränen J., Rikkonen M.,Hyvönen M., Kääriäinen L. (1996) T7 vectors with modified T7lac promoter for expression of proteins in E; Backbone Size:4476; Vector Backbone:pHAT2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: CKAP2 was cloned from testis mouse cDNA
Proper citation: RRID:Addgene_175946 Copy
Species: Mus musculus
Genetic Insert: CKAP2
Vector Backbone Description: Backbone Marker:Peränen J., Rikkonen M.,Hyvönen M., Kääriäinen L. (1996) T7 vectors with modified T7lac promoter for expression of proteins in E; Backbone Size:4476; Vector Backbone:pHAT2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_175947 Copy
Species: Mus musculus
Genetic Insert: Olfr2 gRNA
Vector Backbone Description: Backbone Size:7099; Vector Backbone:pSIN; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_175935 Copy
Species: Mus musculus
Genetic Insert: Gapdh gRNA
Vector Backbone Description: Backbone Size:7097; Vector Backbone:pSIN; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_175938 Copy
Species: Mus musculus
Genetic Insert: rhotekin
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_176100 Copy
Species: Mus musculus
Genetic Insert: phosphatidylinositol 3-kinase
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/2022.10.17.512253 for bioRxiv preprint.
Proper citation: RRID:Addgene_176102 Copy
Species: Mus musculus
Genetic Insert: rhotekin
Vector Backbone Description: Vector Backbone:pEntr1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_176137 Copy
Species: Mus musculus
Genetic Insert: HES1
Vector Backbone Description: Backbone Marker:Linzhao Cheng Lab; Backbone Size:8200; Vector Backbone:EF.v-CMV.GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: The CMV promoter was inserted immediately upstream of GFP in the EF.GFP LV to make the intermediate LV, EF.V-CMV.GFP. mHES1 was cloned downstream of the EF-1a promoter.
Recombinant LVs were produced by transient transfection of the transducing vector into 293T cells with two packaging vectors: pMD.G, a plasmid expressing the VSV-G envelope gene, and pCMVDeltaR8.91, a plasmid expressing the HIV-1 gag/pol, tat, and rev genes.
Proper citation: RRID:Addgene_17622 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
