Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Comments: #107
Proper citation: RRID:Addgene_25676 Copy
Species: Homo sapiens
Genetic Insert: E74-like factor 3 (ets domain transcription factor, epithelial-specific )
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:5200; Vector Backbone:pIRESpuro2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_25728 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Comments: #828
Proper citation: RRID:Addgene_25689 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Comments: #824
Proper citation: RRID:Addgene_25686 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Comments: #827
Proper citation: RRID:Addgene_25688 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Comments: Site-directed mutagnesis was performed on pEBB XIAP W310A to change H467 to Ala (CAT to GCT). This mutation destroys the E3 Ub ligase function of XIAP.
#723
Proper citation: RRID:Addgene_25682 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Comments: Site-directed mutagnesis was performed on pEBB XIAP W310A to introduce a stop codon at AA 449 (AAG to TGA).
#723
Proper citation: RRID:Addgene_25681 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Comments: XIAP W310A was cloned into the BamHI/NotI sites of pEBB FLAG
#739
Proper citation: RRID:Addgene_25684 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Comments: XIAP D148A was cloned into BamHI/NotI sites of pEBB FLAG.
#738
Proper citation: RRID:Addgene_25683 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Comments: Site-directed mutagenesis was performed on pEBB XIAP to change H467 to Ala (CAT to GCT). This mutation destroys the E3 Ub ligase function of XIAP.
Proper citation: RRID:Addgene_25680 Copy
Species: Homo sapiens
Genetic Insert: U6 snRNP
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pAV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9068795
Comments: The U6+27 cassette was constructed by PCR amplification from 265 nucleotides upstream of the human U6 gene transcription initiation site through the first 27 nucleotides of the transcribed gene.
Proper citation: RRID:Addgene_25709 Copy
Species: Homo sapiens
Genetic Insert: Axin 2 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11940574
Comments: Contains AXIN2 sequences from -1078 to +5 relative to the presumed transcription start site.
Proper citation: RRID:Addgene_25701 Copy
Species: Homo sapiens
Genetic Insert: Nanog
Vector Backbone Description: Backbone Size:8377; Vector Backbone:FUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19898493
Proper citation: RRID:Addgene_25700 Copy
Species: Homo sapiens
Genetic Insert: FRB
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20581846
Comments: FRB is a small domain derived from full length mTOR. In brief, rapamycin binds to a protein called FKBP12. Rapamycin bound to FKBP12 inhibits mTOR signaling
Proper citation: RRID:Addgene_25919 Copy
Species: Homo sapiens
Genetic Insert: RapR-FAK
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20581846
Proper citation: RRID:Addgene_25928 Copy
Species: Homo sapiens
Genetic Insert: PQBP1 with Y65C mutation
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5300; Vector Backbone:pcDNA4-His-MaxA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20410308
Proper citation: RRID:Addgene_25803 Copy
Species: Homo sapiens
Genetic Insert: FRB
Vector Backbone Description: Backbone Size:3900; Vector Backbone:pCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20581846
Comments: FRB is a small domain derived from full length mTOR. In brief, rapamycin binds to a protein called FKBP12. Rapamycin bound to FKBP12 inhibits mTOR signaling
Proper citation: RRID:Addgene_25920 Copy
Species: Homo sapiens
Genetic Insert: DICER-Promoter upstream Ebox Mut
Vector Backbone Description: Backbone Size:5394; Vector Backbone:pGL3 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20550935
Proper citation: RRID:Addgene_25852 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-30c
Vector Backbone Description: Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19584398
Comments: miR-30c sequence: 5'TGTAAACATCCTACACTCTCAGC3'
Proper citation: RRID:Addgene_25797 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-150
Vector Backbone Description: Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19584398
Proper citation: RRID:Addgene_25792 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
