Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,915 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pmirGLO-3'UTR mouse Il13 mutDRACH
 
Resource Report
Resource Website 		RRID:Addgene_207130 Interleukin 13 (Il13) 3'UTR Mus musculus Ampicillin PMID:37386028 Backbone Marker:Promega; Backbone Size:7362; Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin TGAGGAGAGACCATCCCTGGGCATCTCAGCTGTGGACTCATTTTCCTTTCTCACATCAGACTTT to TGAGGAGAGcgCtTCCCTGGGCATCTCAGCTGTGGtacCATTTTCCTTTCTCACATCAagCTTT - 1st DRACH site mutated contains AfeI restriction site, 2d DRACH contains KpnI restriction site and 3d DRACH site mutated contains HindIII restriction site. 2026-07-25 12:59:31 0
pCR 2.1-TOPO Fzd6HA
 
Resource Report
Resource Website 		RRID:Addgene_208363 Fzd6 Mus musculus Ampicillin and Kanamycin PMID:37622728 Vector Backbone:pCR2.1; Vector Types:cloning vector; Bacterial Resistance:Ampicillin and Kanamycin 2026-07-25 12:59:30 0
pCR 2.1-TOPO Fzd6 S354I HA
 
Resource Report
Resource Website 		RRID:Addgene_208364 Fzd6 Mus musculus Ampicillin and Kanamycin PMID:37622728 Vector Backbone:pCR2.1; Vector Types:cloning vector; Bacterial Resistance:Ampicillin and Kanamycin Serine 354 to Isoleucine 2026-07-25 12:59:30 0
pcDNA TfR1-TREER
 
Resource Report
Resource Website 		RRID:Addgene_208325 TfR1-TREER Mus musculus Ampicillin PMID:37167569 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:59:33 0
pcDNA TfR1-PuRRRE
 
Resource Report
Resource Website 		RRID:Addgene_208327 TfR1-PuRRRE Mus musculus Ampicillin PMID:37167569 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:59:33 0
pCX:γB2-EC1-G4S-mTQ2ΔC6
 
Resource Report
Resource Website 		RRID:Addgene_209091 PcdhgB2 Mus musculus Ampicillin PMID:34782670 Backbone Size:4778; Vector Backbone:pCX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:59:34 0
pCXLE-Sox2-T2A-Klf4-E2A-Myc
 
Resource Report
Resource Website 		RRID:Addgene_210018 Sox2-t2a-Klf4-e2a-cMyc Mus musculus Ampicillin PMID:38141611 Please visit https://www.biorxiv.org/content/10.1101/2022.09.23.509242v1 for BioRxiv preprint Backbone Size:10180; Vector Backbone:pCXLE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:59:34 0
pCXLE-Sox2-17-T2A-Klf4-E2A-Myc
 
Resource Report
Resource Website 		RRID:Addgene_210016 Sox2-17-t2a-Klf4-e2a-cMyc Mus musculus Ampicillin PMID:38141611 Please visit https://www.biorxiv.org/content/10.1101/2022.09.23.509242v1 for BioRxiv preprint Backbone Size:10180; Vector Backbone:pCXLE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Sox2-17 is engineered highly cooperative chimeric transcription factor, where the following elements of Sox2 were swapped with Sox17: 43-47, 61, 65-86 and CTD 2026-07-25 12:59:34 0
pENTR223-CMV-Cre-U6-sgKdm6a#4-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
 
Resource Report
Resource Website 		RRID:Addgene_209061 KDM6A Mus musculus Spectinomycin PMID:37591951 Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway vector to be used for LR reaction; Bacterial Resistance:Spectinomycin 2026-07-25 12:59:33 0
pMIGII-TCR-C
 
Resource Report
Resource Website 		RRID:Addgene_194389 TCR-C Mus musculus Ampicillin PMID:38363829 Backbone Marker:Addgene #52107; Backbone Size:6512; Vector Backbone:pMIGII; Vector Types:Retroviral; Bacterial Resistance:Ampicillin WT 2026-07-25 12:59:34 0
2M-Mx-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_206942 MmMT3, MxEnc Mus musculus Ampicillin PMID:37069313 Vector Backbone:pcDNA 3.1 (+) Zeo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:59:35 0
pMIGII-TCR-E
 
Resource Report
Resource Website 		RRID:Addgene_194391 TCR-E Mus musculus Ampicillin PMID:38363829 Backbone Marker:Addgene #52107; Backbone Size:6512; Vector Backbone:pMIGII; Vector Types:Retroviral; Bacterial Resistance:Ampicillin WT 2026-07-25 12:59:34 0
pMIAII-TCR-D
 
Resource Report
Resource Website 		RRID:Addgene_194397 TCR-D Mus musculus Ampicillin PMID:38363829 Backbone Marker:Addgene #52113; Backbone Size:6476; Vector Backbone:pMIAII; Vector Types:Retroviral; Bacterial Resistance:Ampicillin WT 2026-07-25 12:59:34 0
pMIGII-TCR-F
 
Resource Report
Resource Website 		RRID:Addgene_194392 TCR-F Mus musculus Ampicillin PMID:38363829 Backbone Marker:Addgene #52107; Backbone Size:6512; Vector Backbone:pMIGII; Vector Types:Retroviral; Bacterial Resistance:Ampicillin WT 2026-07-25 12:59:34 0
pMIAII-TCR-G
 
Resource Report
Resource Website 		RRID:Addgene_194400 TCR-G Mus musculus Ampicillin PMID:38363829 Backbone Marker:Addgene #52113; Backbone Size:6476; Vector Backbone:pMIAII; Vector Types:Retroviral; Bacterial Resistance:Ampicillin WT 2026-07-25 12:59:35 0
SpyTag003(V114T, V116T)-Talin rod-mCherry
 
Resource Report
Resource Website 		RRID:Addgene_210027 SpyTag003(V114T,V116T)-Talin1 rod domain(434-2541)-mCherry Mus musculus Kanamycin PMID:38104267 Backbone Marker:Clontech; Backbone Size:3964; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin SpyTag003 V114T and V116T mutations to modify SpyCatcher003 association rate. These mutations do not block isopeptide bond formation. 2026-07-25 12:59:34 0
EGFP-Talin head-SpyCatcher003(K31TAG)
 
Resource Report
Resource Website 		RRID:Addgene_210023 EGFP-Talin head (1-433)-SpyCatcher003(K31TAG) Mus musculus Ampicillin PMID:38104267 Backbone Marker:Described in PMID: 33069552; Backbone Size:5959; Vector Backbone:Modified pcDNA3 (1xU6-PylT, 1xH1-PylT); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin SpyCatcher003 with K31TAG (Amber stop codon) mutation to allow incorporation of unnatural amino acids. 2026-07-25 12:59:34 0
LifeAct-mNeonGreen -IRES- Talin head-SpyTag003
 
Resource Report
Resource Website 		RRID:Addgene_210024 LifeAct-mNeonGreen co-expressed with Talin head(1-433)-SpyTag003 Mus musculus Ampicillin PMID:38104267 Backbone Marker:Described in PMID: 33069552; Backbone Size:5959; Vector Backbone:Modified pcDNA3 (1xU6-PylT, 1xH1-PylT); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Encephalomyocarditis virus internal ribosome entry site (IRES) with 6A bifurcation loop to improve translation efficiency of 3' ORF 2026-07-25 12:59:34 0
pAAV-CMV-FLEX-SaCas9-U6-sgTh(2)
 
Resource Report
Resource Website 		RRID:Addgene_209198 Th Mus musculus Ampicillin PMID:33740416 Backbone Marker:Larry Zweifel (Addgene plasmid # 124844); Vector Backbone:pAAV-FLEX-SaCas9-U6-sgRNA; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-07-25 12:59:36 0
pAAV-CMV-FLEX-SaCas9-U6-sgKcnma1
 
Resource Report
Resource Website 		RRID:Addgene_209199 Kcnma1 Mus musculus Ampicillin PMID:37566654 Backbone Marker:Larry Zweifel (Addgene plasmid # 124844); Vector Backbone:pAAV-FLEX-SaCas9-U6-sgRNA; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-07-25 12:59:36 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch