Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:8292; Vector Backbone:pGAD424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18722998
Proper citation: RRID:Addgene_19784 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:9033; Vector Backbone:pGAD424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18778253
Proper citation: RRID:Addgene_19783 Copy
Genetic Insert: Firefly Luciferase
Vector Backbone Description: Backbone Size:8072; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_19785 Copy
Species: Homo sapiens
Genetic Insert: NFRKB
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5400; Vector Backbone:BacPAK8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18922472
Proper citation: RRID:Addgene_19788 Copy
Genetic Insert: Scrambled miRNA
Vector Backbone Description: Backbone Size:8200; Vector Backbone:pCAG-EGFP/RFP-int; Vector Types:Mammalian Expression, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18840295
Comments: A fragment of ~400 bases surrounding the miRNA insertion site was amplified from the first intron of the vector pUbC-miRNA-EGFP [36] with primers 5'-GCAATGACGCGATCGCTAATGCGGGAAAGCTCTTATTCGGGT-3' (forward) and 5'-AAGGCATGACGCGTTGTTGCGGCCGCCAGAGGTCCGGCGCCTGT-3' (reverse).
miR-Scr:
GGTACCTGCTGTTGACAGTGAGCGACGATGCTCTAATCGGTTCTATCAAGTGAAGCCACAGATGTTGATAGAACCTTAGAGCATCGCTGCCTACTGCCTCGGACTTCAAGGGGAATTC
Proper citation: RRID:Addgene_19821 Copy
Species: Homo sapiens
Genetic Insert: NFRKB
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5700; Vector Backbone:pET19b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18922472
Proper citation: RRID:Addgene_19787 Copy
Genetic Insert: miRNA
Vector Backbone Description: Backbone Size:8200; Vector Backbone:pCAG-EGFP/RFP-int; Vector Types:Mammalian Expression, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18840295
Comments: A fragment of ~400 bases surrounding the miRNA insertion site was amplified from the first intron of the vector pUbC-miRNA-EGFP [36] with primers 5'-GCAATGACGCGATCGCTAATGCGGGAAAGCTCTTATTCGGGT-3' (forward) and 5'-AAGGCATGACGCGTTGTTGCGGCCGCCAGAGGTCCGGCGCCTGT-3' (reverse).
miR-E2-4:
GGTACCTGCTGTTGACAGTGAGCGAGAAGTGGTGTATCTAGAGATTATAGTGAAGCCACAGATGTATAATCTCTATACACCACTTCCTGCCTACTGCCTCGGACTTCAAGGGGAATTC
Proper citation: RRID:Addgene_19820 Copy
Genetic Insert: Scrambled miRNA
Vector Backbone Description: Backbone Size:6300; Vector Backbone:pCAG-RFP-int; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18840295
Comments: miR-Scr sequence:
GGTACCTGCTGTTGACAGTGAGCGACGATGCTCTAATCGGTTCTATCAAGTGAAGCCACAGATGTTGATAGAACCTTAGAGCATCGCTGCCTACTGCCTCGGACTTCAAGGGGAATTC
Proper citation: RRID:Addgene_19825 Copy
Genetic Insert: miRNA
Vector Backbone Description: Backbone Size:6300; Vector Backbone:pCAG-RFP-int; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18840295
Comments: miR-E2-4 sequence:
GGTACCTGCTGTTGACAGTGAGCGAGAAGTGGTGTATCTAGAGATTATAGTGAAGCCACAGATGTATAATCTCTATACACCACTTCCTGCCTACTGCCTCGGACTTCAAGGGGAATTC
Proper citation: RRID:Addgene_19824 Copy
Species: Homo sapiens
Genetic Insert: quaking homolog, KH domain RNA binding
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19870 Copy
Species: Homo sapiens
Genetic Insert: yfpsynhdat
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:6516; Vector Backbone:pcihygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12065645
Proper citation: RRID:Addgene_19991 Copy
Species: Homo sapiens
Genetic Insert: Dopamine transporter
Vector Backbone Description: Backbone Marker:Glaxowellcome,CLONTECH.; Backbone Size:5764; Vector Backbone:pcin4, pIREShygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10823899
Proper citation: RRID:Addgene_19990 Copy
Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 2
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19872 Copy
Species: Homo sapiens
Genetic Insert: Neurofibromatosis type I
Vector Backbone Description: Backbone Marker:clonetech; Backbone Size:5524; Vector Backbone:pGBT9; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8628317
Comments: The authors note that there is a mutation in the coding sequence: C3918T
"This created a T to I change within the GAP domain of NF1. However, this
change is outside of the conserved blocks within the GAP domain. This
particular residue (1195 of NF1-GRD shown in figure 4 in the chapter by
M.R. Kim and F. Tamanoi, chapter 6 in Neurofibromatosis type I from
genotype to phenotype, editor by M. Upadhyaya and D. N. Cooper BIOS
scientific publisher) is not conserved among different GAP proteins.
Therefore, we believe that the amino acid change does not affect the GAP
activity. In fact, we have used this construct for the wild-type GAP
activity."
Proper citation: RRID:Addgene_19993 Copy
Species: Rattus norvegicus
Genetic Insert: mammalian target of rapamycin-E2419K
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17360675
Proper citation: RRID:Addgene_19994 Copy
Species: Homo sapiens
Genetic Insert: PABPC4
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Comments: Please note that the full PABPC4 sequence may differ from the depositor's sequence. Please see pFRT/TO/FLAG/HA-DEST PABPC4 (Plasmid #19882) for reference.
Proper citation: RRID:Addgene_19877 Copy
Species: Homo sapiens
Genetic Insert: Insulin-like growth factor 2 mRNA binding protein 3
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19879 Copy
Species: Homo sapiens
Genetic Insert: F-box and WD repeat domain containing 5 delta F
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5437; Vector Backbone:pcDNA3-myc3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18381890
Comments: F-Box Deletion Mutant
(L45M mutation present but does not affect function)
Proper citation: RRID:Addgene_19912 Copy
Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 4
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19890 Copy
Species: Homo sapiens
Genetic Insert: Poly(A) binding protein, cytoplasmic 4
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19882 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
