Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: P100
Vector Backbone Description: Vector Backbone:pCLXSN(GFP); Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31086255
Proper citation: RRID:Addgene_174738 Copy
Species: Escherichia phage PK1A2
Genetic Insert: endoNA2-S706A
Vector Backbone Description: Backbone Marker:Finne lab; Backbone Size:7102; Vector Backbone:pFEndoNA2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34315766
Comments: This plasmid can be amplified and maintained in ampicillin-sensitive E. coli strains that harbor the lacIq mutation (such as XL1 Blue and JM109) or carries the pREP4 repressor plasmid (such as M15 [pREP4]).
Proper citation: RRID:Addgene_174730 Copy
Species: Corynebacterium diphtheriae
Genetic Insert: DT386F
Vector Backbone Description: Backbone Marker:Finne lab; Backbone Size:7102; Vector Backbone:pFEndoNA2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34315766
Comments: This plasmid can be amplified and maintained in ampicillin-sensitive E. coli strains that harbor the lacIq mutation (such as XL1 Blue and JM109) or carries the pREP4 repressor plasmid (such as M15 [pREP4]).
Proper citation: RRID:Addgene_174731 Copy
Species: Aequorea victoria, Yersinia enterocolitica, Escherichia phage PK1A
Genetic Insert: GFP-endoNA fusion protein
Vector Backbone Description: Backbone Marker:QIAGEN; Backbone Size:3463; Vector Backbone:pQE-31; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15627620
Comments: This plasmid can be amplified and maintained in ampicillin-sensitive E. coli strains that harbor the lacIq mutation (such as XL1 Blue and JM109) or carries the pREP4 repressor plasmid (such as M15 [pREP4]).
Proper citation: RRID:Addgene_174724 Copy
Vector Backbone Description: Backbone Size:4506; Vector Backbone:pKO403; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:35023783
Proper citation: RRID:Addgene_174726 Copy
Species: Discosoma sp.
Genetic Insert: DsRed-Monomer
Vector Backbone Description: Backbone Marker:Finne lab; Backbone Size:7102; Vector Backbone:pFEndoNA2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29203765
Comments: This plasmid can be amplified and maintained in ampicillin-sensitive E. coli strains that harbor the lacIq mutation (such as XL1 Blue and JM109) or carries the pREP4 repressor plasmid (such as M15 [pREP4]).
Proper citation: RRID:Addgene_174728 Copy
Species: Homo sapiens
Genetic Insert: OTUB1
Vector Backbone Description: Vector Backbone:pPRIChp; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31182807
Proper citation: RRID:Addgene_174743 Copy
Species: Mus musculus
Genetic Insert: TBK1
Vector Backbone Description: Vector Backbone:pMIGR1; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_174741 Copy
Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-L17E/D481V-6xHA, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454
Proper citation: RRID:Addgene_174777 Copy
Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-eGFP, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454
Proper citation: RRID:Addgene_174778 Copy
Species: Homo sapiens
Genetic Insert: ALC1-K77R
Vector Backbone Description: Vector Backbone:pET41; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-897 (a start codon included in-frame)
Please note: Plasmid contains R25P and S743C natural variants in ALC1.
Proper citation: RRID:Addgene_174813 Copy
Species: Homo sapiens
Genetic Insert: ALC1-E175Q
Vector Backbone Description: Vector Backbone:pET41; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-897 (a start codon included in-frame).
Please note: Plasmid contains R25P and S743C natural variants in ALC1.
Proper citation: RRID:Addgene_174814 Copy
Genetic Insert: Enhanced green fluorescent protein shRNA #2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2556; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19657394
Comments: shRNA sequence is- 5'-CCGCTGGAGTACAACTACAACTTCAAGAGAGTTGTAGTTGTACTCCAGCTTTTT
Proper citation: RRID:Addgene_17471 Copy
Genetic Insert: Firefly Luciferase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2240; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_17473 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:8931; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral, RNAi, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_17474 Copy
Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-L17E-4xMyc, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454
Proper citation: RRID:Addgene_174772 Copy
Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-L17E/D481V-4xMyc, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454
Proper citation: RRID:Addgene_174773 Copy
Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-6xHA, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454
Proper citation: RRID:Addgene_174774 Copy
Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-D481V-6xHA, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454
Proper citation: RRID:Addgene_174775 Copy
Genetic Insert: Enhanced green fluorescent protein shRNA #1
Vector Backbone Description: Backbone Size:7919; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Comments: shRNA oligo sequence - CGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTCTTTTT
Proper citation: RRID:Addgene_17479 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
