Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Myt1L
Vector Backbone Description: Backbone Size:7139; Vector Backbone:pCCL-cppt-PGK-MIRT124_x4 Xma_lost.WPRE; Vector Types:Mammalian Expression, Yeast Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25482564
Proper citation: RRID:Addgene_67293 Copy
Species: Mus musculus
Genetic Insert: Asc1
Vector Backbone Description: Backbone Size:7041; Vector Backbone:pCCL-cppt-PGK-WPRE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25482564
Proper citation: RRID:Addgene_67291 Copy
Species: Mus musculus
Genetic Insert: Brsk1
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19648910
Proper citation: RRID:Addgene_67149 Copy
Species: Mus musculus
Genetic Insert: Src homology 2 domain-containing phosphatase 2
Vector Backbone Description: Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25802336
Proper citation: RRID:Addgene_67577 Copy
Species: Mus musculus
Genetic Insert: Nrf2
Vector Backbone Description: Backbone Marker:Jeng-Shin Lee, Harvard University; Backbone Size:5422; Vector Backbone:AAV-MCS8; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25798616
Proper citation: RRID:Addgene_67636 Copy
Species: Mus musculus
Genetic Insert: PGC1a
Vector Backbone Description: Backbone Marker:Jeng-Shin Lee, Harvard University; Vector Backbone:AAV-GFP; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25798616
Comments: Flag-PGC1a-6His sequence was obtained from Bruce Spiegelman Lab. Note that there is a Q339K mutation relative to the canonical GenBank sequence. This mutation has not been reported to affect function.
Proper citation: RRID:Addgene_67637 Copy
Species: Mus musculus
Genetic Insert: sgNeo
Vector Backbone Description: Vector Backbone:pLL3.3; Vector Types:Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26178787
Proper citation: RRID:Addgene_67594 Copy
Species: Mus musculus
Genetic Insert: SOD-2A-Catalase
Vector Backbone Description: Backbone Marker:Jeng-Shin Lee, Harvard University; Vector Backbone:AAV-MCS8; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25798616
Proper citation: RRID:Addgene_67635 Copy
Species: Mus musculus
Genetic Insert: 2 binding sites for miR-141
Vector Backbone Description: Backbone Size:6273; Vector Backbone:psiCHECK-2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25401471
Proper citation: RRID:Addgene_67632 Copy
Species: Mus musculus
Genetic Insert: MBII85 snoRNA
Vector Backbone Description: Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26220404
Proper citation: RRID:Addgene_67631 Copy
Species: Mus musculus
Genetic Insert: MBII52 snoRNA
Vector Backbone Description: Vector Backbone:pCR4-TOPO; Vector Types:for in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26220404
Proper citation: RRID:Addgene_67647 Copy
Species: Mus musculus
Genetic Insert: MBII85 snoRNA
Vector Backbone Description: Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26220404
Proper citation: RRID:Addgene_67645 Copy
Species: Mus musculus
Genetic Insert: MBII85 snoRNA
Vector Backbone Description: Vector Backbone:pCRII-TOPO; Vector Types:for in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26220404
Proper citation: RRID:Addgene_67646 Copy
Species: Mus musculus
Genetic Insert: MBII85 snoRNA
Vector Backbone Description: Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26220404
Proper citation: RRID:Addgene_67643 Copy
Species: Mus musculus
Genetic Insert: ZFP809
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19270682
Proper citation: RRID:Addgene_67788 Copy
Species: Mus musculus
Genetic Insert: EKLF
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4969; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9707565
Comments: Mutations G299S, and T305S have no functional consequences.
Proper citation: RRID:Addgene_67836 Copy
Species: Mus musculus
Genetic Insert: EKLF
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11287616
Comments: Mutations G299S, T305S have no functional consequences.
Proper citation: RRID:Addgene_67837 Copy
Species: Mus musculus
Genetic Insert: EKLF
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25197097
Comments: Entire EKLF open reading frame is defined as nucleotides 71-1215 and described in PMID 7682653. Mutations G299S and T305S have no functional consequences.
Proper citation: RRID:Addgene_67833 Copy
Species: Mus musculus
Genetic Insert: AAV-hsyn-flexed-dsRed-miR30-vgat2.shRNA
Vector Backbone Description: Backbone Size:2700; Vector Backbone:pUC; Vector Types:Mammalian Expression, Mouse Targeting, AAV, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26094607
Comments: this plasmid is modified from the pRIME system. See:
Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A
lentiviral microRNA-based system for single-copy polymerase II-regulated
RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102,
13212–13217
We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664), as the building block to make the AAV-hsyn-flex-dsRed-miR30-vgat2.shRNA plasmid.
transgene expression is Cre-dependent; contains flex switch
All the enzymes are unique cutters, except EcoRI and XhoI, the insert dsRed-shRNA can be retrieved using AscI and NheI, giving 1.2kb and 4.8kb bands.
The insert was read using primers in the dsred sequence:
dsred 410: CGTAATGCAGAAGAAGACTATG
dsred 530R: CCATGTAGATGGACTTGAACTC
Proper citation: RRID:Addgene_67845 Copy
Species: Mus musculus
Genetic Insert: Cav3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:peGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10385524
Proper citation: RRID:Addgene_67886 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.