Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pGEX4T-1-mMcl-1(T144A) Resource Report Resource Website |
RRID:Addgene_25382 | mMCL1(T144A) | Mus musculus | Ampicillin | PMID:19433446 | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | changed threonine 144 to alanine | 2026-07-25 12:44:58 | 0 | |
|
HMGA2 shRNA Resource Report Resource Website |
RRID:Addgene_25408 | high mobility group AT-Hook 2 | Mus musculus | Chloramphenicol | PMID:18957199 | pPRIME-CMV-GFP-FF3 is available from Addgene. HMGA2 shRNA sequence: TGCTGTTGACAGTGAGCGATTTGTGGATCTGATAAGCAAGTAGTGAAGCCACAGATGTACTTGCTTATCAGATCCACAAACTGCCTACTGCCTCGGA | Backbone Marker:Elledge lab, Addgene plasmid 11663; Backbone Size:8509; Vector Backbone:pPRIME-CMV-GFP-FF3; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol | None | 2026-07-25 12:44:58 | 0 |
|
HMGA2-FLAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_25409 | high mobility group AT-Hook 2 | Mus musculus | Ampicillin | PMID:18957199 | Backbone Marker:Gift from David Baltimore; Backbone Size:6500; Vector Backbone:pMIG; Vector Types:Mammalian Expression, Retroviral, ChIP; Bacterial Resistance:Ampicillin | None | 2026-07-25 12:44:58 | 2 | |
|
pGL3-24p3/LCN2-Luc Resource Report Resource Website 1+ mentions |
RRID:Addgene_25463 | 24p3/lipocalin 2 proximal promoter | Mus musculus | Ampicillin | PMID:15591425 | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | none | 2026-07-25 12:44:58 | 2 | |
|
pEGFP-mSmo Resource Report Resource Website 10+ mentions |
RRID:Addgene_25395 | mouse Smoothened cDNA | Mus musculus | Kanamycin | PMID:12414725 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:44:58 | 13 | ||
|
YFP-mDia1FH2deltaN Resource Report Resource Website |
RRID:Addgene_25419 | diaph1 | Mus musculus | Kanamycin | PMID:17198702 | Also see Copeland, J. W., and R. Treisman. 2002. The Diaphanous-related Formin mDia1 Controls Serum Response Factor Activity through its Effects on Actin Polymerization. Mol Biol Cell 13:4088-99 for information about FH2∆N2 mutation. | Backbone Marker:clontech Invitrogen; Backbone Size:4700; Vector Backbone:YFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | mDia1 FH2∆N2 sequence (encodes amino acids 771-1182) | 2026-07-25 12:44:58 | 0 |
|
pEGFPm-DAD Resource Report Resource Website 1+ mentions |
RRID:Addgene_25410 | Diap3 | Mus musculus | Ampicillin | PMID:11035012 | The Q1091P mutation in the DAD region was not intentional and may have been a cloning error. | Backbone Size:3000; Vector Backbone:EF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | mDia2 Amino Acids 1031-1171; Q1091P mutation | 2026-07-25 12:44:58 | 1 |
|
pCMVSport6/mPax3 Resource Report Resource Website |
RRID:Addgene_25426 | Pax3 | Mus musculus | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:4400; Vector Backbone:pCMV-Sport6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:58 | 0 | |||
|
pEN_hU6miR-G13-L Resource Report Resource Website |
RRID:Addgene_25758 | G alpha 13 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with U6-driven G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT | Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-07-25 12:45:01 | 0 | |
|
pEN_TGmiR_Gb2-K Resource Report Resource Website |
RRID:Addgene_25766 | Gb2 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with TRE-driven G beta 2 miR-shRNA (TGCTCATGTATTCCCACGACAA) and co-expressed GFP | Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-07-25 12:45:02 | 0 | |
|
pEN_TmiR_G12-E Resource Report Resource Website |
RRID:Addgene_25761 | G alpha 12 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with TRE-driven G alpha 12 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT Addgene sequence shows that this plasmid is missing the EcoRI and SpeI sites. | Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-07-25 12:45:01 | 0 | |
|
pGli3a Resource Report Resource Website 1+ mentions |
RRID:Addgene_25733 | Gli3 | Mus musculus | Ampicillin | PMID:8387379 | Insert containing the entire ZnF domain | Backbone Size:2958; Vector Backbone:pBluescript II (KS); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:01 | 1 | |
|
pSLIK-Neo-TmiR-Gb2 Resource Report Resource Website |
RRID:Addgene_25744 | Gb2 | Mus musculus | Ampicillin | PMID:16945906 | pSLIK-Neo with TRE-driven G beta 2 miR-shRNA G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA | Backbone Marker:Iain Fraser; Backbone Size:12486; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:01 | 0 | |
|
pSLIK-Venus-TmiR-G13 Resource Report Resource Website |
RRID:Addgene_25741 | G alpha 13 miR-shRNA | Mus musculus | Ampicillin | PMID:16945906 | pSLIK-Venus with G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT | Backbone Marker:Iain Fraser; Backbone Size:12370; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:01 | 0 | |
|
pCDNA3-HA-mMcl1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25714 | mMCL1 | Mus musculus | Ampicillin | PMID:19433446 | Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:01 | 1 | ||
|
(G38) pCRII-Wnt10b/b-globin Resource Report Resource Website |
RRID:Addgene_25877 | Wnt10b / b-globin | Mus musculus | Ampicillin | PMID:15190075 | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:02 | 0 | ||
|
(P79) OCN/Wnt 10b transgene Resource Report Resource Website |
RRID:Addgene_25878 | Wnt10b | Mus musculus | Ampicillin | See attached map for details. The entire OCN-Wnt10b-b-globin product can be excised with HindIII/XhoI for a ~6.1 kB fragment | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:02 | 0 | ||
|
myc-Rapr-FAK-YM Resource Report Resource Website 1+ mentions |
RRID:Addgene_25927 | RapR-FAK | Mus musculus | Ampicillin | PMID:20581846 | Backbone Size:5500; Vector Backbone:pRc/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | This myc-RapR-FAK-YM plasmid contains FAK mutations Y180A and M183A. (The sequence data uploaded to addgene is based on wt). | 2026-07-25 12:45:03 | 1 | |
|
myc-Rapr-FAK Resource Report Resource Website 1+ mentions |
RRID:Addgene_25926 | RapR-FAK | Mus musculus | Ampicillin | PMID:20581846 | Backbone Size:5500; Vector Backbone:pRc/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:03 | 1 | ||
|
(E6) CMV-p18 C/EBPalpha Resource Report Resource Website |
RRID:Addgene_25881 | p18 C/EBPalpha | Mus musculus | Ampicillin | PMID:11340085 | To create a non-His-tagged form of CR4, His-p18C/EBPα was linearized with HindIII, and a fill-in reaction was performed to blunt end the vector. The linearized vector was then digested with BglII, and the resulting fragment was subcloned into the BamHI-EcoRV site of pcDNA3.1(+) (Invitrogen) containing an ideal Kozak consensus sequence oligonucleotide (AGCTTGCGGCCGCCACCATGGG) 5′ to theBamHI site. p18 refers to the fact that this is an N-terminally truncated His fusion corresponding to roughly 18kDa. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N-terminal truncation, contains only CR4 and bZIP domains. | 2026-07-25 12:45:02 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
