Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: mMCL1(T144A)
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_25382 Copy
Species: Mus musculus
Genetic Insert: high mobility group AT-Hook 2
Vector Backbone Description: Backbone Marker:Elledge lab, Addgene plasmid 11663; Backbone Size:8509; Vector Backbone:pPRIME-CMV-GFP-FF3; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol
References:
Comments: pPRIME-CMV-GFP-FF3 is available from Addgene.
HMGA2 shRNA sequence:
TGCTGTTGACAGTGAGCGATTTGTGGATCTGATAAGCAAGTAGTGAAGCCACAGATGTACTTGCTTATCAGATCCACAAACTGCCTACTGCCTCGGA
Proper citation: RRID:Addgene_25408 Copy
Species: Mus musculus
Genetic Insert: high mobility group AT-Hook 2
Vector Backbone Description: Backbone Marker:Gift from David Baltimore; Backbone Size:6500; Vector Backbone:pMIG; Vector Types:Mammalian Expression, Retroviral, ChIP; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_25409 Copy
Species: Mus musculus
Genetic Insert: 24p3/lipocalin 2 proximal promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_25463 Copy
Species: Mus musculus
Genetic Insert: mouse Smoothened cDNA
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_25395 Copy
Species: Mus musculus
Genetic Insert: diaph1
Vector Backbone Description: Backbone Marker:clontech Invitrogen; Backbone Size:4700; Vector Backbone:YFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Also see Copeland, J. W., and R. Treisman. 2002. The Diaphanous-related Formin mDia1 Controls Serum Response Factor Activity through its Effects on Actin Polymerization. Mol Biol Cell 13:4088-99 for information about FH2∆N2 mutation.
Proper citation: RRID:Addgene_25419 Copy
Species: Mus musculus
Genetic Insert: Diap3
Vector Backbone Description: Backbone Size:3000; Vector Backbone:EF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The Q1091P mutation in the DAD region was not intentional and may have been a cloning error.
Proper citation: RRID:Addgene_25410 Copy
Species: Mus musculus
Genetic Insert: Pax3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4400; Vector Backbone:pCMV-Sport6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_25426 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: Entry vector with U6-driven G alpha 13 miR-shRNA
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
Proper citation: RRID:Addgene_25758 Copy
Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: Entry vector with TRE-driven G beta 2 miR-shRNA (TGCTCATGTATTCCCACGACAA) and co-expressed GFP
Proper citation: RRID:Addgene_25766 Copy
Species: Mus musculus
Genetic Insert: G alpha 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: Entry vector with TRE-driven G alpha 12 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
Addgene sequence shows that this plasmid is missing the EcoRI and SpeI sites.
Proper citation: RRID:Addgene_25761 Copy
Species: Mus musculus
Genetic Insert: Gli3
Vector Backbone Description: Backbone Size:2958; Vector Backbone:pBluescript II (KS); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Insert containing the entire ZnF domain
Proper citation: RRID:Addgene_25733 Copy
Species: Mus musculus
Genetic Insert: Gb2
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:12486; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: pSLIK-Neo with TRE-driven G beta 2 miR-shRNA
G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA
Proper citation: RRID:Addgene_25744 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 miR-shRNA
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:12370; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: pSLIK-Venus with G alpha 13 miR-shRNA
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
Proper citation: RRID:Addgene_25741 Copy
Species: Mus musculus
Genetic Insert: mMCL1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_25714 Copy
Species: Mus musculus
Genetic Insert: Wnt10b / b-globin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_25877 Copy
Species: Mus musculus
Genetic Insert: Wnt10b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin
References:
Comments: See attached map for details.
The entire OCN-Wnt10b-b-globin product can be excised with HindIII/XhoI for a ~6.1 kB fragment
Proper citation: RRID:Addgene_25878 Copy
Species: Mus musculus
Genetic Insert: RapR-FAK
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pRc/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_25927 Copy
Species: Mus musculus
Genetic Insert: RapR-FAK
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pRc/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_25926 Copy
Species: Mus musculus
Genetic Insert: p18 C/EBPalpha
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: To create a non-His-tagged form of CR4, His-p18C/EBPα was linearized with HindIII, and a fill-in reaction was performed to blunt end the vector. The linearized vector was then digested with BglII, and the resulting fragment was subcloned into the BamHI-EcoRV site of pcDNA3.1(+) (Invitrogen) containing an ideal Kozak consensus sequence oligonucleotide (AGCTTGCGGCCGCCACCATGGG) 5′ to theBamHI site.
p18 refers to the fact that this is an N-terminally truncated His fusion corresponding to roughly 18kDa.
Proper citation: RRID:Addgene_25881 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
