Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
FRAP Resource Report Resource Website |
RRID:Addgene_1827 | FR1 AP | Mus musculus | Ampicillin | PMID:1309590 | See scanned map. (Leder #C-281) | Backbone Size:0; Vector Backbone:APtag-1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:57 | 0 | |
|
pSK-c-mpl Resource Report Resource Website |
RRID:Addgene_1828 | c-mpl | Mus musculus | Ampicillin | PMID:8334987 | See scanned map. (Leder #C-320) | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript II SK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:57 | 0 | |
|
pOC2 Gria1-GFP KI Resource Report Resource Website 1+ mentions |
RRID:Addgene_183430 | gRNA and GFP donor | Mus musculus | Ampicillin | PMID:35851300 | Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. | Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:58 | 1 | |
|
pOC2 Dlg4-Halo KI Resource Report Resource Website |
RRID:Addgene_183449 | gRNA and Halo donor | Mus musculus | Ampicillin | PMID:35851300 | Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. | Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:58 | 0 | |
|
GST-30A Resource Report Resource Website 1+ mentions |
RRID:Addgene_1845 | FBP30 WW-A | Mus musculus | Ampicillin | PMID:10744724 | (Leder #C-1094) | Backbone Marker:Amersham; Backbone Size:4969; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:00 | 1 | |
|
GST-30A&B Resource Report Resource Website 1+ mentions |
RRID:Addgene_1847 | FBP30 WW-A WW-B | Mus musculus | Ampicillin | PMID:10744724 | (Leder #C-1096) | Backbone Marker:Amersham; Backbone Size:4969; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:00 | 1 | |
|
HIPK1-myc-his Resource Report Resource Website |
RRID:Addgene_1850 | HIPK1 | Mus musculus | Ampicillin | PMID:12529400 | See scanned map. (Leder #JE64) | Backbone Size:5500; Vector Backbone:pcDNA3.1/myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:00 | 0 | |
|
p3xFLAG-Tmprss6(Mask) Resource Report Resource Website |
RRID:Addgene_18790 | Type II transmembrane serine protease 6 | Mus musculus | Ampicillin | PMID:18451267 | Backbone Size:6265; Vector Backbone:p3xFLAG-CMV-14 (Sigma); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted amino acids 567-811 and replaced with 28 abberant amino acids. | 2026-07-25 12:44:03 | 0 | |
|
p3xFLAG-Tmprss6(S762A) Resource Report Resource Website 1+ mentions |
RRID:Addgene_18791 | Type II transmembrane serine protease 6 | Mus musculus | Ampicillin | PMID:18451267 | Backbone Size:6265; Vector Backbone:p3xFLAG-CMV-14; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed Serine762 to Alanine | 2026-07-25 12:44:03 | 2 | |
|
pWZL Blast Twist ER Resource Report Resource Website 1+ mentions |
RRID:Addgene_18799 | twist | Mus musculus | Ampicillin | PMID:18485877 | pWZL-Blast-Twist-ER was generated by replacing the MYC cDNA of pWZL-Blast-DN-MycER (Littlewood et al., 1995; Watnick et al., 2003) with the mTwist cDNA PCR amplified from pBp-mTwist. | Backbone Size:5100; Vector Backbone:pWZL-Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | G525R mutation in the ER. The presence of the G525R point mutation in the cloned ER sequence abrogates its binding to 17β-estradiol while keeping its full sensitivity to the synthetic ligand 4'hydroxytamoxifen (4OHT) | 2026-07-25 12:44:03 | 8 |
|
MSCV eIF4E IRES GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_18761 | eIF4E | Mus musculus | Ampicillin | PMID:15029198 | Backbone Size:0; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:03 | 1 | ||
|
MSCV eIF4E W73A IRES GFP Resource Report Resource Website |
RRID:Addgene_18762 | eIF4E W73A | Mus musculus | Ampicillin | PMID:18055695 | Backbone Size:0; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | W73A | 2026-07-25 12:44:03 | 0 | |
|
MSCV eIF4E S209D IRES GFP Resource Report Resource Website |
RRID:Addgene_18765 | eIF4E S209D | Mus musculus | Ampicillin | PMID:18055695 | Backbone Size:0; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | S209D | 2026-07-25 12:44:03 | 0 | |
|
MSCV Myc IRES GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_18770 | Myc | Mus musculus | Ampicillin | PMID:16094360 | Backbone Size:0; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:03 | 6 | ||
|
pGL3B-1081 Resource Report Resource Website 1+ mentions |
RRID:Addgene_18759 | thioredoxin-interacting protein promoter | Mus musculus | Ampicillin | PMID:16301999 | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:03 | 5 | ||
|
pCMV mouse sidekick1 Resource Report Resource Website |
RRID:Addgene_18734 | Sidekick-1 | Mus musculus | Kanamycin | PMID:18216854 | A Sidekick fragment was amplified from an IMAGE clone and inserted into pCMVscript. The sequence GGCCGCGGCATGGCCCGCGCCCGGCCCTCGGT GGCGGGCGGCGGAGTCGCGGCGCCCCCTGAGC GAGCGGGGCCCGGGC was then inserted 5' of this fragment to complete the open reading frame. | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV script; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:44:03 | 0 | |
|
pCMV mouse Dscam-like Resource Report Resource Website 1+ mentions |
RRID:Addgene_18738 | DscamL | Mus musculus | Kanamycin | PMID:18216854 | A fragment of mouse Dscam-like-1 cDNA was amplified from the mKIAA1132 plasmid (Kazusa DNA Research Institute) using the following primers: GGCCGCGGCCGCCCGCACGGCCGGCCACAGGACCACC and CGCGGTCGACAGGTCCCAGTGTGGAGCCCTTCTCC. This fragment was cloned into the NotI/SalI sites of pCMVscript. To complete its open reading frame, a BglII fragment of this plasmid was replaced by a cDNA amplified from mouse brain using the following primers: GGCCAGATCTCCGCACGGCCGGCCACAGGACCACC and CGCGAGATCTGTTGCCGTTGTGCTTGAGGGAGAC. | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV script; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:44:03 | 2 | |
|
pBabe-HA-mMcl-1 Resource Report Resource Website |
RRID:Addgene_25385 | mMCL1 | Mus musculus | Ampicillin | PMID:19433446 | Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:58 | 0 | ||
|
pBabe-HA-mMcl-1(S140A) Resource Report Resource Website |
RRID:Addgene_25387 | mMCL1(S140A) | Mus musculus | Ampicillin | PMID:19433446 | Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | changed serine 140 to alanine | 2026-07-25 12:44:58 | 0 | |
|
pCDNA3-HA-mMcl1(S140A) Resource Report Resource Website |
RRID:Addgene_25383 | mMCL1(S140A) | Mus musculus | Ampicillin | PMID:19433446 | Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | changed serine 140 to alanine | 2026-07-25 12:44:58 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
