Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Hepatitis C Virus
Genetic Insert: NS3-NS4A protease
Vector Backbone Description: Backbone Marker:Novagen/Northeast Structural Genomics Consortium; Backbone Size:5680; Vector Backbone:pET15Sumo2_NESG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_254048 Copy
Species: Homo sapiens
Genetic Insert: LDLR
Vector Backbone Description: Vector Backbone:lentiTet-LDLR-mCherry BlastR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41473288
Comments: Please visit https://doi.org/10.64898/2025.12.16.694467 for bioRxiv preprint.
Proper citation: RRID:Addgene_254323 Copy
Species: West Nile Virus
Genetic Insert: NS3
Vector Backbone Description: Backbone Marker:Novagen/Northeast Structural Genomics Consortium; Backbone Size:5680; Vector Backbone:pET15Sumo2_NESG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_254047 Copy
Species: Hepatitis C Virus
Genetic Insert: NS3
Vector Backbone Description: Backbone Marker:Novagen/Northeast Structural Genomics Consortium; Backbone Size:5680; Vector Backbone:pET15Sumo2_NESG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_254049 Copy
Species: Homo sapiens
Genetic Insert: shRNA 369958 and Rabep1
Vector Backbone Description: Vector Backbone:pLKO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41701563
Comments: Infusion Cloning. Please visit https://doi.org/10.1101/2025.05.08.652481 for bioRxiv preprint.
Proper citation: RRID:Addgene_254779 Copy
Vector Backbone Description: Vector Backbone:pUC18T-miniTn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41670347
Proper citation: RRID:Addgene_253727 Copy
Genetic Insert: Carries a single chromosomal copy of constitutively active PhoP downstream of PcpcG2 promoter inserted in nupG locus
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:41996246
Comments: For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion.
Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint.
Proper citation: RRID:Addgene_254897 Copy
Genetic Insert: Carries a single chromosomal copy of the repressor TetR downstream of PcpcG2 promoter inserted in nupG locus
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:41996246
Comments: For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion.
Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint.
Proper citation: RRID:Addgene_254898 Copy
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pDGB1_alpha1; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39733396
Proper citation: RRID:Addgene_253731 Copy
Species: Synthetic
Genetic Insert: FRET-OFF
Vector Backbone Description: Backbone Marker:Eric Campeau Lab (Addgene Plasmid #17392); Vector Backbone:pLenti CMV Neo DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41210971
Proper citation: RRID:Addgene_254590 Copy
Species: Synthetic
Genetic Insert: st-CoChR-GP2A-mScarlet
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_253384 Copy
Species: Synthetic
Genetic Insert: Bacterial transcription unit encoding P-trna promoter and Broccoli-tRNA fluorogenic aptamer
Vector Backbone Description: Backbone Marker:GeneArt (Thermo Fisher Scientific); Backbone Size:2414; Vector Backbone:pOA-RQ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.64898/2026.02.09.704077 for bioRxiv preprint.
Proper citation: RRID:Addgene_254596 Copy
Species: Synthetic
Genetic Insert: Quetzal-Cy
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_253387 Copy
Species: Synthetic
Genetic Insert: Bacterial transcription unit encoding P-fla promoter and Broccoli-tRNA fluorogenic aptamer
Vector Backbone Description: Backbone Marker:GeneArt (Thermo Fisher Scientific); Backbone Size:2414; Vector Backbone:pOA-RQ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.64898/2026.02.09.704077 for bioRxiv preprint.
Proper citation: RRID:Addgene_254597 Copy
Species: Synthetic
Genetic Insert: Quetzal-S
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_253389 Copy
Species: Homo sapiens
Genetic Insert: Rabep1
Vector Backbone Description: Vector Backbone:Tol2-lyzc; Vector Types:Zebrafish Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41701563
Comments: Infusion Cloning. Please visit https://doi.org/10.1101/2025.05.08.652481 for bioRxiv preprint.
Proper citation: RRID:Addgene_254769 Copy
Species: Homo sapiens
Genetic Insert: Rabep1
Vector Backbone Description: Vector Backbone:Tol2-lyzc; Vector Types:Zebrafish Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41701563
Comments: Infusion Cloning. Please visit https://doi.org/10.1101/2025.05.08.652481 for bioRxiv preprint.
Proper citation: RRID:Addgene_254768 Copy
Species: Rhinovirus Type 2
Genetic Insert: 3C protease
Vector Backbone Description: Backbone Marker:Novagen/Northeast Structural Genomics Consortium; Backbone Size:5727; Vector Backbone:pET15AviHTSumoTOEET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Related to PDB: 1CQQ
Proper citation: RRID:Addgene_254122 Copy
Species: Homo sapiens
Genetic Insert: AP2-associated protein kinase 1
Vector Backbone Description: Vector Backbone:pAAV-TRE-mTurquoise2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_254004 Copy
Species: Homo sapiens
Genetic Insert: LMNA
Vector Backbone Description: Backbone Size:5629; Vector Backbone:pLPC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_254401 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
