Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Mortalin/GRP75 scFv [N52A/42] Resource Report Resource Website |
RRID:Addgene_182091 | recombinant mouse scFv targeting Mortalin/GRP75 (Mus musculus) | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895583. GA code: 80B. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:54 | 0 | |
|
C-Fos scFv [N486/32] Resource Report Resource Website |
RRID:Addgene_182090 | recombinant mouse scFv targeting C-Fos (Homo sapiens) | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895689. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:54 | 0 | |
|
GluN2B/NR2B glutamate receptor scFv [N59/36] Resource Report Resource Website |
RRID:Addgene_182093 | recombinant mouse scFv targeting GluN2B/NR2B glutamate receptor (Rattus norvegicus) | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895584. GA code: 59A. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:54 | 0 | |
|
GFP scFv [N86/38] Resource Report Resource Website |
RRID:Addgene_182095 | recombinant mouse scFv targeting GFP | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895586. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:54 | 0 | |
|
PB-TO-ASCL1-DLX2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_182307 | Ascl1 | Mus musculus | Ampicillin | PMID:40672309 | Backbone Size:12978; Vector Backbone:pUCM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:56 | 1 | ||
|
PX552-mScn2a-3xV5-EF1-smFP-flag Resource Report Resource Website |
RRID:Addgene_182561 | mouse Scn2a gRNA and 3xV5 donor DNA | Mus musculus | Ampicillin | PMID:35672149 | Vector Backbone:PX552; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:56 | 0 | ||
|
piggybac-Syn-mScn8a_ICL1-sfGFP-P2A-mCherry Resource Report Resource Website |
RRID:Addgene_182560 | mouse Scn8a ICL1 | Mus musculus | Ampicillin | PMID:35672149 | Vector Backbone:Piggybac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:56 | 0 | ||
|
PX552-mScn8a-HaloTag-V5-EF1-sfGFP Resource Report Resource Website |
RRID:Addgene_182565 | mouse Scn8a gRNA and HaloTag-V5 donor DNA | Mus musculus | Ampicillin | PMID:35672149 | Vector Backbone:PX552; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:56 | 0 | ||
|
PX552-mScn2a-HaloTag-V5-EF1-sfGFP Resource Report Resource Website |
RRID:Addgene_182564 | mouse Scn2a gRNA and HaloTag-V5 donor DNA | Mus musculus | Ampicillin | PMID:35672149 | Vector Backbone:PX552; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:56 | 0 | ||
|
psiCheck2-SV40p-mtIF3(SR)-3xFLAG-HSVTKp-mCherry Resource Report Resource Website |
RRID:Addgene_182381 | mtIF3 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:3639; Vector Backbone:psiCheck2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed CDS sequence from 'ccacgttcaagtcacgataaa' to 'tcatgtacaggtgaccattaa' (shRNA-resistant) | 2026-07-25 12:43:56 | 0 | |
|
psiCheck2-SV40p-mtIF3(SR)-3xFLAG-CMVp-mito-mTFP1 Resource Report Resource Website |
RRID:Addgene_182380 | mtIF3 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:3386; Vector Backbone:psiCheck2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed CDS sequence from 'ccacgttcaagtcacgataaa' to 'tcatgtacaggtgaccattaa' (shRNA-resistant) | 2026-07-25 12:43:56 | 0 | |
|
pAAV2-mtIF3 shRNA_TagRFP657 Resource Report Resource Website |
RRID:Addgene_182367 | mtIF3 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:5813; Vector Backbone:pAAV2; Vector Types:Mammalian Expression, AAV, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:56 | 0 | ||
|
pcDNA6-5'UTR(mtIF3)-Dendra2-3'UTR(mtIF3) Resource Report Resource Website |
RRID:Addgene_182369 | mtIF3 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:4991; Vector Backbone:pcDNA6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:56 | 0 | ||
|
pcDNA6-MRPS6-VN172 Resource Report Resource Website |
RRID:Addgene_182374 | Mrps6 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:5060; Vector Backbone:pcDNA6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:56 | 0 | ||
|
pcDNA6-MRPL50-VC155 Resource Report Resource Website |
RRID:Addgene_182373 | Mrpl50 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:5060; Vector Backbone:pcDNA6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:56 | 0 | ||
|
pcDNA6-5'UTR(mtIF3)-mtIF3-Dendra2-3'UTR(mtIF3) Resource Report Resource Website |
RRID:Addgene_182370 | mtIF3 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:4991; Vector Backbone:pcDNA6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:56 | 0 | ||
|
pcDNA6-mtIF3-Dendra2 Resource Report Resource Website |
RRID:Addgene_182371 | mtIF3 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:5089; Vector Backbone:pcDNA6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:56 | 0 | ||
|
pAAV-iCre-2A-venus Resource Report Resource Website |
RRID:Addgene_182499 | iCre-2A-Venus | Mus musculus | Ampicillin | PMID:35649726 | Please note there is a G6E in the insert. Depositor confirms this mutation does not affect plasmid function. | Backbone Size:310; Vector Backbone:pUC; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:56 | 0 | |
|
psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-HSVTKp-mCherry Resource Report Resource Website |
RRID:Addgene_182379 | mtIF3 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:3679; Vector Backbone:psiCheck2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed CDS sequence from 'ccacgttcaagtcacgataaa' to 'tcatgtacaggtgaccattaa' (shRNA-resistant) | 2026-07-25 12:43:56 | 0 | |
|
BA-Wnt10b Resource Report Resource Website 1+ mentions |
RRID:Addgene_1831 | Wnt10b | Mus musculus | Ampicillin | PMID:9393971 | See scanned map. (Leder #C-893) | Backbone Size:3200; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:43:58 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
