Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 419 showing 8361 ~ 8380 out of 12,915 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_16389

    This resource has 10+ mentions.

http://www.addgene.org/16389

Species: Mus musculus
Genetic Insert: PKC delta isoform 2
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pHACE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_16389 Copy   

    • RRID:Addgene_16388

    This resource has 1+ mentions.

http://www.addgene.org/16388

Species: Mus musculus
Genetic Insert: PKC delta
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pHACE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_16388 Copy   

    • RRID:Addgene_16387

http://www.addgene.org/16387

Species: Mus musculus
Genetic Insert: PKC delta
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pHACE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_16387 Copy   

    • RRID:Addgene_16386

    This resource has 10+ mentions.

http://www.addgene.org/16386

Species: Mus musculus
Genetic Insert: PKC delta isoform 2
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pHACE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_16386 Copy   

    • RRID:Addgene_16385

    This resource has 1+ mentions.

http://www.addgene.org/16385

Species: Mus musculus
Genetic Insert: PKC beta II
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pHACE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_16385 Copy   

    • RRID:Addgene_16383

    This resource has 1+ mentions.

http://www.addgene.org/16383

Species: Mus musculus
Genetic Insert: PKC beta II
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pHACE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_16383 Copy   

http://www.addgene.org/163870

Species: Mus musculus
Genetic Insert: Ctcf
Vector Backbone Description: Vector Backbone:pflox; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_163870 Copy   

http://www.addgene.org/163872

Species: Mus musculus
Genetic Insert: Spt5
Vector Backbone Description: Vector Backbone:pflox; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_163872 Copy   

http://www.addgene.org/163871

Species: Mus musculus
Genetic Insert: Rad21
Vector Backbone Description: Vector Backbone:pflox; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_163871 Copy   

http://www.addgene.org/163873

Species: Mus musculus
Genetic Insert: Wapl
Vector Backbone Description: Vector Backbone:pflox; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_163873 Copy   

http://www.addgene.org/163876

Species: Mus musculus
Genetic Insert: Brm
Vector Backbone Description: Vector Backbone:pflox; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_163876 Copy   

    • RRID:Addgene_15379

    This resource has 1+ mentions.

http://www.addgene.org/15379

Species: Mus musculus
Genetic Insert: short hairpin RNA against mouse Mi-2 beta
Vector Backbone Description: Backbone Marker:Smale Lab; Backbone Size:8290; Vector Backbone:pQsupR; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: Target sequence: GACTACGACCTGTTCAAGCAG

Proper citation: RRID:Addgene_15379 Copy   

    • RRID:Addgene_15380

    This resource has 1+ mentions.

http://www.addgene.org/15380

Species: Mus musculus
Genetic Insert: mU6-BRG/BRM shRNA
Vector Backbone Description: Backbone Marker:Smale lab; Backbone Size:8017; Vector Backbone:pRVGP; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: Mouse U6 promoter followed by short hairpin RNA against mouse BRG/BRM genes. Target sequence: TGGAGAAGCAGCAGAAGATT.

Proper citation: RRID:Addgene_15380 Copy   

    • RRID:Addgene_15394

http://www.addgene.org/15394

Species: Mus musculus
Genetic Insert: Upstream region of mouse Esg1 gene
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGV-BM2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_15394 Copy   

http://www.addgene.org/153947

Species: Mus musculus
Genetic Insert: Otx2
Vector Backbone Description: Backbone Size:7061; Vector Backbone:PiggyBac transposon; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_153947 Copy   

http://www.addgene.org/154001

Species: Mus musculus
Genetic Insert: CasRx, Ptbp1 sgRNAs
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: INSERT 1: CasRx driven by GFAP promoter. INSERT 2: DR-SgRNA_Ptbp1 driven by U6 promoter. Ptbp1 gRNA 5: 5′-tgtagatgggctgtccacgaagcactggcg-3′ Ptbp1 gRNA 6: 5′-gcttggagaagtcgatgcgcagcgtgcagc-3′

Proper citation: RRID:Addgene_154001 Copy   

    • RRID:Addgene_15411

http://www.addgene.org/15411

Species: Mus musculus
Genetic Insert: MED6
Vector Backbone Description: Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_15411 Copy   

    • RRID:Addgene_15408

http://www.addgene.org/15408

Species: Mus musculus
Genetic Insert: MED9
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5900; Vector Backbone:pET41a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_15408 Copy   

    • RRID:Addgene_154090

    This resource has 1+ mentions.

http://www.addgene.org/154090

Species: Mus musculus
Genetic Insert: sgRNA targeting murine B2M locus
Vector Backbone Description: Backbone Marker:Derived from pX458 (Zhang lab); Backbone Size:9500; Vector Backbone:pQCi; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.03.25.008276v4 for bioRxiv preprint.

Proper citation: RRID:Addgene_154090 Copy   

http://www.addgene.org/154140

Species: Mus musculus
Genetic Insert: scFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
Vector Backbone Description: Backbone Size:2663; Vector Backbone:AmpR-Ori; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_154140 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch