Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 418 showing 8341 ~ 8360 out of 12,915 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_175152

    This resource has 1+ mentions.

http://www.addgene.org/175152

Species: Mus musculus
Genetic Insert: Tmem9b
Vector Backbone Description: Backbone Marker:Tobias Meyer (Addgene plasmid # 85132); Vector Backbone:pLV-EF1a-IRES-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_175152 Copy   


  • RRID:Addgene_175106

http://www.addgene.org/175106

Species: Mus musculus
Genetic Insert: Cbx1
Vector Backbone Description: Backbone Marker:Tobias Meyer (Addgene plasmid # 85132); Vector Backbone:pLV-EF1a-IRES-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_175106 Copy   


  • RRID:Addgene_175109

http://www.addgene.org/175109

Species: Mus musculus
Genetic Insert: Lmnb2
Vector Backbone Description: Backbone Marker:Tobias Meyer (Addgene plasmid # 85132); Vector Backbone:pLV-EF1a-IRES-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_175109 Copy   


  • RRID:Addgene_175100

http://www.addgene.org/175100

Species: Mus musculus
Genetic Insert: Lbr
Vector Backbone Description: Backbone Marker:Tobias Meyer (Addgene plasmid # 85132); Vector Backbone:pLV-EF1a-IRES-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: TbID, TurboID: Nat Biotechnol. (2018) 36:880-887

Proper citation: RRID:Addgene_175100 Copy   


  • RRID:Addgene_175102

http://www.addgene.org/175102

Species: Mus musculus
Genetic Insert: Lbr
Vector Backbone Description: Backbone Marker:Tobias Meyer (Addgene plasmid # 85132); Vector Backbone:pLV-EF1a-IRES-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_175102 Copy   


  • RRID:Addgene_175105

http://www.addgene.org/175105

Species: Mus musculus
Genetic Insert: Cbx5
Vector Backbone Description: Backbone Marker:Tobias Meyer (Addgene plasmid # 85132); Vector Backbone:pLV-EF1a-IRES-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_175105 Copy   


http://www.addgene.org/175181

Species: Mus musculus
Genetic Insert: pAAV hSyn FLEX iGluSnFR3 v857.GPI
Vector Backbone Description: Backbone Size:4836; Vector Backbone:pAAV hSyn FLEX; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_175181 Copy   


  • RRID:Addgene_17522

http://www.addgene.org/17522

Species: Mus musculus
Genetic Insert: Pax7
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBRIT-LoxP-HA/FLAG-puro; Vector Types:Mammalian Expression, Retroviral, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_17522 Copy   


http://www.addgene.org/175172

Species: Mus musculus
Genetic Insert: Myorg
Vector Backbone Description: Backbone Marker:Tom Misteli (Addgene plasmid # 22661); Vector Backbone:pCDHblast-MCSNard OST-LMNA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: predicted catalytic site inactivating mutation

Proper citation: RRID:Addgene_175172 Copy   


  • RRID:Addgene_175359

    This resource has 1+ mentions.

http://www.addgene.org/175359

Species: Mus musculus
Genetic Insert: anti-FLAG M2 heavy chain
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_175359 Copy   


  • RRID:Addgene_17547

    This resource has 1+ mentions.

http://www.addgene.org/17547

Species: Mus musculus
Genetic Insert: Foxo1 AAA
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Plasmid contains polymorphisms K219R and L619P, which are not thought to affect plasmid function.

Proper citation: RRID:Addgene_17547 Copy   


  • RRID:Addgene_17551

    This resource has 10+ mentions.

http://www.addgene.org/17551

Species: Mus musculus
Genetic Insert: pEGFP-N1 Foxo1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Has polymorphism L619P

Proper citation: RRID:Addgene_17551 Copy   


  • RRID:Addgene_17558

http://www.addgene.org/17558

Species: Mus musculus
Genetic Insert: Foxo1 6KR
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Plasmid contains K219R and L619P polymorphisms.

Proper citation: RRID:Addgene_17558 Copy   


  • RRID:Addgene_175493

http://www.addgene.org/175493

Species: Mus musculus
Genetic Insert: Single chain Fv CD44 antibody (H90)
Vector Backbone Description: Vector Backbone:pNIC-CTH0; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: Ligation-independent cloning 5' site TTAAGAAGGAGATATACTATG ; 3' site GATTGGAAGTAGAGGTTCTCTGC. Gileadi lab uses DH10-Bac or SF9 cells for expression.

Proper citation: RRID:Addgene_175493 Copy   


http://www.addgene.org/175551

Species: Mus musculus
Genetic Insert: spCas9-nickase and sgRNA against mouse WAPL STOP Codon
Vector Backbone Description: Backbone Marker:Addgene 42335; Vector Backbone:pX335; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_175551 Copy   


  • RRID:Addgene_175500

http://www.addgene.org/175500

Species: Mus musculus
Genetic Insert: Vps50
Vector Backbone Description: Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_175500 Copy   


  • RRID:Addgene_17562

    This resource has 1+ mentions.

http://www.addgene.org/17562

Species: Mus musculus
Genetic Insert: Foxo1 6KQ
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Plasmid has K219R and L619P polymorphisms which are not thought to affect plasmid function.

Proper citation: RRID:Addgene_17562 Copy   


  • RRID:Addgene_175943

http://www.addgene.org/175943

Species: Mus musculus
Genetic Insert: CD45 gRNA
Vector Backbone Description: Backbone Size:7099; Vector Backbone:pSIN; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_175943 Copy   


  • RRID:Addgene_175946

http://www.addgene.org/175946

Species: Mus musculus
Genetic Insert: CKAP2
Vector Backbone Description: Backbone Marker:Peränen J., Rikkonen M.,Hyvönen M., Kääriäinen L. (1996) T7 vectors with modified T7lac promoter for expression of proteins in E; Backbone Size:4476; Vector Backbone:pHAT2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: CKAP2 was cloned from testis mouse cDNA

Proper citation: RRID:Addgene_175946 Copy   


http://www.addgene.org/175947

Species: Mus musculus
Genetic Insert: CKAP2
Vector Backbone Description: Backbone Marker:Peränen J., Rikkonen M.,Hyvönen M., Kääriäinen L. (1996) T7 vectors with modified T7lac promoter for expression of proteins in E; Backbone Size:4476; Vector Backbone:pHAT2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_175947 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X