Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: SpCas9 and sgAAVS1-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2000; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451765
Proper citation: RRID:Addgene_129726 Copy
Species: Homo sapiens
Genetic Insert: Seipin
Vector Backbone Description: Backbone Size:8000; Vector Backbone:pSH-EFIRES-B; Vector Types:Mammalian Expression, CRISPR, TALEN, Human safe harbor locus (A AVS1) site-specific integration; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451765
Proper citation: RRID:Addgene_129719 Copy
Species: Homo sapiens
Genetic Insert: ADRB2
Vector Backbone Description: Backbone Marker:Genewiz; Backbone Size:6350; Vector Backbone:pUC57; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33084570
Proper citation: RRID:Addgene_129789 Copy
Species: Homo sapiens
Genetic Insert: human MYC
Vector Backbone Description: Vector Backbone:pT3-EF1a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31186238
Comments: The plasmid contains loxp sites so it´s not ideal for experiments in mice expressing Cre.
Proper citation: RRID:Addgene_129776 Copy
Species: Homo sapiens
Genetic Insert: Rac1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6100; Vector Backbone:pcDNA3-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10734125
Proper citation: RRID:Addgene_12980 Copy
Species: Homo sapiens
Genetic Insert: TSP-2
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Includes 1.6 kb of the 3' untranslated region. Note that there is an internal EcoRI site.
The clone was isolated from a cDNA library to prepare probes. We did not submit a sequence of TSP-2 to the NCBI. There are mismatches with NCBI sequence may be polymorophisms.
Proper citation: RRID:Addgene_12994 Copy
Species: Homo sapiens
Genetic Insert: human sulfatase 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1/Myc-His(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12368295
Proper citation: RRID:Addgene_13004 Copy
Species: Homo sapiens
Genetic Insert: COMP
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7713493
Comments: Includes complete coding region.
Proper citation: RRID:Addgene_13002 Copy
Species: Homo sapiens
Genetic Insert: human sulfatase 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1/Myc-His(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12368295
Proper citation: RRID:Addgene_13003 Copy
Species: Homo sapiens
Genetic Insert: Toll-Like Receptor 1
Vector Backbone Description: Backbone Size:6100; Vector Backbone:pcDNA3-YFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'
Proper citation: RRID:Addgene_13014 Copy
Species: Homo sapiens
Genetic Insert: Wolfram Syndrome 1
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16195229
Proper citation: RRID:Addgene_13012 Copy
Species: Homo sapiens
Genetic Insert: Inositol Requiring Enzyme-1
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16950141
Proper citation: RRID:Addgene_13010 Copy
Species: Homo sapiens
Genetic Insert: Toll-Like Receptor 4
Vector Backbone Description: Backbone Size:6100; Vector Backbone:pcDNA3-YFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'
Proper citation: RRID:Addgene_13018 Copy
Species: Homo sapiens
Genetic Insert: Toll-Like Receptor 8
Vector Backbone Description: Backbone Size:6100; Vector Backbone:pcDNA3-YFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'
Proper citation: RRID:Addgene_13024 Copy
Species: Homo sapiens
Genetic Insert: ELAM
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_13029 Copy
Species: Homo sapiens
Genetic Insert: hHR23B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1D V5 His TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15064742
Comments: You can cut out the hHR23B insert with HindIII and XhoI.
Proper citation: RRID:Addgene_13054 Copy
Species: Homo sapiens
Genetic Insert: Nucleolin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2897; Vector Backbone:pRSET-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10760958
Proper citation: RRID:Addgene_13037 Copy
Species: Homo sapiens
Genetic Insert: GPX-1
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2961; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7684384
Proper citation: RRID:Addgene_13038 Copy
Species: Homo sapiens
Genetic Insert: TPI-PTC1
Vector Backbone Description: Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31155380
Proper citation: RRID:Addgene_130699 Copy
Species: Homo sapiens
Genetic Insert: TPI-Wildtype
Vector Backbone Description: Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31155380
Proper citation: RRID:Addgene_130697 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
