Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: s100a10 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: Fragment was amplified using the following primers:
GCCCAGGTTTCGACAGACT
CCACTAGTGATAGAAAGCTCTGGA
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 21-275 of BC025044, but found single nucleotide mismatches at bp#129 & 190. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45603 Copy
Species: Mus musculus
Genetic Insert: IFT20
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_45608 Copy
Species: Mus musculus
Genetic Insert: nAChRAlpha4-SEP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: PI: Henry Lester
Proper citation: RRID:Addgene_45607 Copy
Species: Mus musculus
Genetic Insert: FoxP1
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pCAGGs; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_45720 Copy
Species: Mus musculus
Genetic Insert: Crym in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: Fragment was amplified using the following primers:
ACTGGCGAGAACTGGATGAC
GCCATCACCCCTTAACAGAA
For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45601 Copy
Species: Mus musculus
Genetic Insert: Pkhd1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_45560 Copy
Species: Mus musculus
Genetic Insert: Sstr3
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_45559 Copy
Species: Mus musculus
Genetic Insert: Couptf1 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 1755-2381 of NM_010151.2, not bp# 1635-2273 as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45870 Copy
Species: Mus musculus
Genetic Insert: Lhx2 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 1809-2217 of NM_010710.3, not bp# 1807-2215 as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45873 Copy
Species: Mus musculus
Genetic Insert: Hnrnpa2b1 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the Spe1 restriction digest and T7 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 1145-1370 (with a single nucleotide mismatch at bp#1280) when compared to NM_182650.3, not bp# 1124-1456 as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45872 Copy
Species: Mus musculus
Genetic Insert: Semcap3 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 3184-3805 of AF127085.1, not bp# 3185-3804 as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45874 Copy
Species: Mus musculus
Genetic Insert: Frmd4b in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: The Frmd4b fragment was amplified by RT-PCR using the following primer pair:
AGCTCCTGAATCGTGGCTTA
TCCTGCAGCTCGGAGTAAAT
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 3933-4535 of NM_145148.2, not bp# 3856-4458 as indicated on plasmid map as indicated on plasmid map as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45867 Copy
Species: Mus musculus
Genetic Insert: eIF2S2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: PCR amplified from GST eIF2beta (addgene plasmid 45900) using EcoRI and BamHI containing primers (+ATG/-STOP).
G321D mutation is also present.
Proper citation: RRID:Addgene_45902 Copy
Species: Mus musculus
Genetic Insert: Btg1 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: The Bgt1 fragment was amplified by RT-PCR using the following primer pair:
TGCCATAGTTTGGACAGTACC
CAAAATAGATGGTGGTTTGTGG
For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 1004-1638 when compared to BC006834.1, not bp# 1004-1638 as indicated on plasmid map as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45865 Copy
Species: Mus musculus
Genetic Insert: Nkx6.1
Vector Backbone Description: Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_45846 Copy
Species: Mus musculus
Genetic Insert: AS9(Mito MTS)-Delta N67-mMCL1
Vector Backbone Description: Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_45822 Copy
Species: Mus musculus
Genetic Insert: mMCL-1
Vector Backbone Description: Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_45817 Copy
Species: Mus musculus
Genetic Insert: 5A, 6A mMCL-1-OM
Vector Backbone Description: Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_45818 Copy
Species: Mus musculus
Genetic Insert: Eif2s2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pZeoSV2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_45898 Copy
Species: Mus musculus
Genetic Insert: nonmuscle myosin heavy chain II-C, isoform C0
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_46040 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
