Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCRII-Topo S100a10 in situ probe Resource Report Resource Website |
RRID:Addgene_45603 | s100a10 in situ probe | Mus musculus | Ampicillin | PMID:15664173 | Fragment was amplified using the following primers: GCCCAGGTTTCGACAGACT CCACTAGTGATAGAAAGCTCTGGA For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 21-275 of BC025044, but found single nucleotide mismatches at bp#129 & 190. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 21-275 of BC025044 | 2026-07-25 12:47:27 | 0 |
|
JAF2.13 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45608 | IFT20 | Mus musculus | Kanamycin | PMID:16775004 | Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:47:27 | 1 | ||
|
pCI-neo-alpha4-SEP Resource Report Resource Website |
RRID:Addgene_45607 | nAChRAlpha4-SEP | Mus musculus | Ampicillin | PMID:21768117 | PI: Henry Lester | Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:27 | 0 | |
|
pCAGGs-Foxp1 Resource Report Resource Website |
RRID:Addgene_45720 | FoxP1 | Mus musculus | Ampicillin | PMID:18662545 | Backbone Size:4800; Vector Backbone:pCAGGs; Vector Types:; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:28 | 0 | ||
|
pCRII-Topo Crym in situ probe Resource Report Resource Website |
RRID:Addgene_45601 | Crym in situ probe | Mus musculus | Ampicillin | PMID:15664173 | Fragment was amplified using the following primers: ACTGGCGAGAACTGGATGAC GCCATCACCCCTTAACAGAA For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains nt 756-1191 of NM_016669 | 2026-07-25 12:47:27 | 0 |
|
JAF99.4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45560 | Pkhd1 | Mus musculus | Kanamycin | PMID:20048263 | Backbone Marker:Clontech; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Contains only the cytoplasmic tail (last 193 amino acids) | 2026-07-25 12:47:27 | 3 | |
|
BD46.32 Resource Report Resource Website |
RRID:Addgene_45559 | Sstr3 | Mus musculus | Kanamycin | PMID:19147004 | Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:47:27 | 0 | ||
|
pCRII-Topo Couptf1 Resource Report Resource Website |
RRID:Addgene_45870 | Couptf1 in situ probe | Mus musculus | Ampicillin | For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1755-2381 of NM_010151.2, not bp# 1635-2273 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | contains bp# 1755-2381 of NM_010151.2 | 2026-07-25 12:47:29 | 0 | |
|
pCRII-Topo Lhx2 Resource Report Resource Website |
RRID:Addgene_45873 | Lhx2 in situ probe | Mus musculus | Ampicillin | For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1809-2217 of NM_010710.3, not bp# 1807-2215 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | contains bp# 1809-2217 of NM_010710.3 | 2026-07-25 12:47:29 | 0 | |
|
pCRII-Topo Hnrp Resource Report Resource Website |
RRID:Addgene_45872 | Hnrnpa2b1 in situ probe | Mus musculus | Ampicillin | For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the Spe1 restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1145-1370 (with a single nucleotide mismatch at bp#1280) when compared to NM_182650.3, not bp# 1124-1456 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | contains bp# 1145-1370 of NM_182650.3 | 2026-07-25 12:47:29 | 0 | |
|
pCRII-Topo Semcap3 Resource Report Resource Website |
RRID:Addgene_45874 | Semcap3 in situ probe | Mus musculus | Ampicillin | For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 3184-3805 of AF127085.1, not bp# 3185-3804 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | contains bp# 3184-3805 of AF127085.1 | 2026-07-25 12:47:29 | 0 | |
|
pCRII-Topo Frmd4b Resource Report Resource Website |
RRID:Addgene_45867 | Frmd4b in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Frmd4b fragment was amplified by RT-PCR using the following primer pair: AGCTCCTGAATCGTGGCTTA TCCTGCAGCTCGGAGTAAAT For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 3933-4535 of NM_145148.2, not bp# 3856-4458 as indicated on plasmid map as indicated on plasmid map as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | contains bp# 3933-4535 of NM_145148.2 | 2026-07-25 12:47:29 | 0 |
|
pEGFP eIF2beta Resource Report Resource Website |
RRID:Addgene_45902 | eIF2S2 | Mus musculus | Kanamycin | PMID:11959995 | PCR amplified from GST eIF2beta (addgene plasmid 45900) using EcoRI and BamHI containing primers (+ATG/-STOP). G321D mutation is also present. | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:47:29 | 0 | |
|
pCRII-Topo Btg1 Resource Report Resource Website |
RRID:Addgene_45865 | Btg1 in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Bgt1 fragment was amplified by RT-PCR using the following primer pair: TGCCATAGTTTGGACAGTACC CAAAATAGATGGTGGTTTGTGG For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1004-1638 when compared to BC006834.1, not bp# 1004-1638 as indicated on plasmid map as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | contains bp# 1004-1638 of BC006834.1 | 2026-07-25 12:47:29 | 0 |
|
Tet-O-FUW-Nkx6.1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45846 | Nkx6.1 | Mus musculus | Ampicillin | PMID:23584610 | Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:29 | 2 | ||
|
pMSCV-puro-AS9 (Mito MTS)-Delta N67-mMCL1 Resource Report Resource Website |
RRID:Addgene_45822 | AS9(Mito MTS)-Delta N67-mMCL1 | Mus musculus | Ampicillin | PMID:22544066 | Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | ATP Synthase subunit 9 is used as a Mito Targeting sequence and fused to Delta N67-mMCL-1 | 2026-07-25 12:47:29 | 0 | |
|
pMSCV-puro-mMCL1-WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_45817 | mMCL-1 | Mus musculus | Ampicillin | PMID:22544066 | Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:29 | 2 | ||
|
pMSCV-puro-5A, 6A mMCL1-OM Resource Report Resource Website |
RRID:Addgene_45818 | 5A, 6A mMCL-1-OM | Mus musculus | Ampicillin | PMID:22544066 | Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed Arginine to Alanine at 5th and 6th amino acids | 2026-07-25 12:47:28 | 0 | |
|
pSV HA eIF2beta WT Resource Report Resource Website |
RRID:Addgene_45898 | Eif2s2 | Mus musculus | Bleocin (Zeocin) | PMID:11959995 | Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pZeoSV2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-07-25 12:47:29 | 0 | ||
|
pNMHCII-C0-GFP Resource Report Resource Website |
RRID:Addgene_46040 | nonmuscle myosin heavy chain II-C, isoform C0 | Mus musculus | Kanamycin | PMID:16790446 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:47:31 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
