Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Src-YF-UniRapR-mCerulean-myc
Vector Backbone Description: Vector Backbone:pUSE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_45381 Copy
Species: Mus musculus
Genetic Insert: PKA regulatory subunit RII alpha tagged by mEGFP
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_45527 Copy
Species: Mus musculus
Genetic Insert: PKA catalytic subunit alpha tagged by mEGFP
Vector Backbone Description: Backbone Marker:Karel Svoboda; Backbone Size:5900; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, with chicken beta actin promoter and WPRE; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_45528 Copy
Species: Mus musculus
Genetic Insert: PKA catalytic subunit alpha tagged by mEGFP
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_45521 Copy
Species: Mus musculus
Genetic Insert: PKA regulatory subunit RI alpha tagged by mEGFP
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_45525 Copy
Species: Mus musculus
Genetic Insert: PKA catalytic subunit alpha tagged by mPAGFP
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_45524 Copy
Species: Mus musculus
Genetic Insert: PGC-1alpha Isoform2
Vector Backbone Description: Backbone Size:5424; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_45502 Copy
Species: Mus musculus
Genetic Insert: Hoxc4
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pCAGGs; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_45550 Copy
Species: Mus musculus
Genetic Insert: 2.5kb mouse Nkx2.5 enhancer and promoter fragment
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4151; Vector Backbone:pEGFP-1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Alternate plasmid name: Nkx2.5 cardiac enhancer-base promoter-eGFP
The full plasmid sequence is approximate and may not be entirely accurate.
Proper citation: RRID:Addgene_45497 Copy
Species: Mus musculus
Genetic Insert: beta Klotho
Vector Backbone Description: Backbone Size:4986; Vector Backbone:pCR3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_45531 Copy
Species: Mus musculus
Genetic Insert: Vglut2 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: For in vitro transcription, use the SpeI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45639 Copy
Species: Mus musculus
Genetic Insert: Cdh10 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the SpeI restriction digest and T7 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45638 Copy
Species: Mus musculus
Genetic Insert: c-Myc T58A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Alternate plasmid names: pD40-His-c-MycT58A; pcDNA-DEST40 Myc T58A
Plasmid construction information:
Point mutations were introduced into the murine c-Myc sequence in the CMV–Myc plasmid (Hann et al., Genes Dev. 1994, PMID: 7958908) using the GeneEditor kit (Promega) per manufacturer's instructions using oligonucletide
MycT58A, 5′-CTGCTTCCCGCCCCGCCCCTGTC-3′.
The His6-tagged c-MycT58A plasmid was then created by PCR amplification with a CACC 5′ extension added to the 5′ primer for cloning into the TOPO entry clone from Invitrogen (Carlsbad, CA). This sequence was then moved into the pDEST-40 mammalian expression vector using Gateway technology (Invitrogen), creating pD40-His-c-MycT58A.
For more plasmid information (map and sequence), see the wildtype version, pD40-His/V5-c-Myc (Addgene plasmid 45597) For additional usage information, see the associated article (Yeh et al. Nat Cell Biol. 2004) as well as Arnold et al. EMBO 2009 (PMID: 19131971).
Proper citation: RRID:Addgene_45598 Copy
Species: Mus musculus
Genetic Insert: Nnmt in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: The Nnmt fragment was amplified by RT-PCR using the following primer pair:
CCTATGTGTGTGATCTTGAAGG
AGATCTGCCTGGCTTTCG
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 454-908 of NM_010924.2 (and contain a single nucleotide mismatch at bp#816), not bp# 529-983 as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45631 Copy
Species: Mus musculus
Genetic Insert: c-Myc S62A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Alternate plasmid names: pD40-His-c-MycS62A; pcDNA-DEST40 Myc S62A
Plasmid construction information:
Point mutations were introduced into the murine c-Myc sequence in the CMV–Myc plasmid (Hann et al., Genes Dev. 1994, PMID: 7958908) using the GeneEditor kit (Promega) per manufacturer's instructions using oligonucletide
MycS62A, 5′-CACCCCGCCCCTGGCCCCGAGC-3′.
The His6-tagged c-MycS62A plasmid was then created by PCR amplification with a CACC 5′ extension added to the 5′ primer for cloning into the TOPO entry clone from Invitrogen (Carlsbad, CA). This sequence was then moved into the pDEST-40 mammalian expression vector using Gateway technology (Invitrogen), creating pD40-His-c-MycS62A.
For more plasmid information (map and sequence), see the wildtype version, pD40-His/V5-c-Myc (Addgene plasmid 45597) For additional usage information, see the associated article (Yeh et al. Nat Cell Biol. 2004) as well as Arnold et al. EMBO 2009 (PMID: 19131971).
Proper citation: RRID:Addgene_45599 Copy
Species: Mus musculus
Genetic Insert: Chn2 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: The Chn2 fragment was amplified by RT-PCR using the following primer pair:
GCATGAGATTTCCACACCAA
TTTCCTTCCATTACACTGTCATAA
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45625 Copy
Species: Mus musculus
Genetic Insert: Epha3 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: The Epha3 fragment was amplified by RT-PCR using the following primer pair:
GTCCAAATGCCTTAAAATGG
CAATAGCATTTGGCACTTGG
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 3179-3773 of NM_010140, not bp# 3180-3774 as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45627 Copy
Species: Mus musculus
Genetic Insert: Hspb3 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: The Hspb3 fragment was amplified by RT-PCR using the following primer pair:
TGATTCAGCCCCAATTAAGC
CTGGGGTATGAAGAGCAACC
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45629 Copy
Species: Mus musculus
Genetic Insert: Cav1 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
References:
Comments: The Cav1 fragment was amplified by RT-PCR using the following primer pair:
ACCTCTCTGGACTGGCAGAA
AGTGTCGGCAAGACTGAAGG
For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the Spe1 restriction digest and T7 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 1472-2124 of AB029929.1, but found single nucleotide mismatches at bp# 1501 & 1574. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45624 Copy
Species: Mus musculus
Genetic Insert: Constitutively active mDia1 (CA-mDia1)
Vector Backbone Description: Backbone Marker:Clontech ; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_45583 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
