Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pUSE-Src-YF-UniRapR-mCerulean-myc Resource Report Resource Website 1+ mentions |
RRID:Addgene_45381 | Src-YF-UniRapR-mCerulean-myc | Mus musculus | Ampicillin | PMID:23569285 | Vector Backbone:pUSE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | changed mSrc Tyrosine 529 to Phenylalanine | 2026-07-25 12:47:26 | 4 | |
|
pCDNA3-mouse PKA-RIIalpha-mEGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_45527 | PKA regulatory subunit RII alpha tagged by mEGFP | Mus musculus | Ampicillin | PMID:19447092 | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:27 | 2 | ||
|
pCAGGS-mouse PKA-Calpha-mEGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_45528 | PKA catalytic subunit alpha tagged by mEGFP | Mus musculus | Ampicillin | PMID:19447092 | Backbone Marker:Karel Svoboda; Backbone Size:5900; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, with chicken beta actin promoter and WPRE; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:27 | 2 | ||
|
pcDNA3-mouse PKA-Calpha-mEGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_45521 | PKA catalytic subunit alpha tagged by mEGFP | Mus musculus | Ampicillin | PMID:19447092 | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:27 | 2 | ||
|
pCDNA3-mouse PKA-RIalpha-mEGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_45525 | PKA regulatory subunit RI alpha tagged by mEGFP | Mus musculus | Ampicillin | PMID:19447092 | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:27 | 2 | ||
|
pcDNA3-mouse PKA-Calpha-mPAGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_45524 | PKA catalytic subunit alpha tagged by mPAGFP | Mus musculus | Ampicillin | PMID:19447092 | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:27 | 1 | ||
|
pcDNA3.1-Flag-PGC-1alpha2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45502 | PGC-1alpha Isoform2 | Mus musculus | Ampicillin | PMID:23217713 | Backbone Size:5424; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:27 | 1 | ||
|
pCAGGS-Hoxc4 Resource Report Resource Website |
RRID:Addgene_45550 | Hoxc4 | Mus musculus | Ampicillin | PMID:23359544 | Backbone Size:4800; Vector Backbone:pCAGGs; Vector Types:; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:27 | 0 | ||
|
pNkx-GFP Resource Report Resource Website |
RRID:Addgene_45497 | 2.5kb mouse Nkx2.5 enhancer and promoter fragment | Mus musculus | Kanamycin | PMID:17123591 | Alternate plasmid name: Nkx2.5 cardiac enhancer-base promoter-eGFP The full plasmid sequence is approximate and may not be entirely accurate. | Backbone Marker:Clontech; Backbone Size:4151; Vector Backbone:pEGFP-1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:47:27 | 0 | |
|
pCMV-Klb-EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_45531 | beta Klotho | Mus musculus | Ampicillin and Kanamycin | PMID:26881702 | Backbone Size:4986; Vector Backbone:pCR3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:47:27 | 2 | ||
|
pCRII-Topo Vglut2 in situ probe Resource Report Resource Website 1+ mentions |
RRID:Addgene_45639 | Vglut2 in situ probe | Mus musculus | Ampicillin | PMID:19657336 | For in vitro transcription, use the SpeI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains nt 2477-2993 of slc17a6 (Vglut2) mRNA sequence (GenBank ID AK045409.1) | 2026-07-25 12:47:28 | 2 |
|
pCRII-Topo Cdh10 in situ probe Resource Report Resource Website |
RRID:Addgene_45638 | Cdh10 in situ probe | Mus musculus | Ampicillin | For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the SpeI restriction digest and T7 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains nt 2628-3061 of Cdh10 (GenBank ID AF183946) | 2026-07-25 12:47:28 | 0 | |
|
pD40-His/V5-c-MycT58A Resource Report Resource Website 1+ mentions |
RRID:Addgene_45598 | c-Myc T58A | Mus musculus | Ampicillin | PMID:15048125 | Alternate plasmid names: pD40-His-c-MycT58A; pcDNA-DEST40 Myc T58A Plasmid construction information: Point mutations were introduced into the murine c-Myc sequence in the CMV–Myc plasmid (Hann et al., Genes Dev. 1994, PMID: 7958908) using the GeneEditor kit (Promega) per manufacturer's instructions using oligonucletide MycT58A, 5′-CTGCTTCCCGCCCCGCCCCTGTC-3′. The His6-tagged c-MycT58A plasmid was then created by PCR amplification with a CACC 5′ extension added to the 5′ primer for cloning into the TOPO entry clone from Invitrogen (Carlsbad, CA). This sequence was then moved into the pDEST-40 mammalian expression vector using Gateway technology (Invitrogen), creating pD40-His-c-MycT58A. For more plasmid information (map and sequence), see the wildtype version, pD40-His/V5-c-Myc (Addgene plasmid 45597) For additional usage information, see the associated article (Yeh et al. Nat Cell Biol. 2004) as well as Arnold et al. EMBO 2009 (PMID: 19131971). | Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | T58A | 2026-07-25 12:47:27 | 6 |
|
pCRII-Topo Nnmt in situ probe Resource Report Resource Website |
RRID:Addgene_45631 | Nnmt in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Nnmt fragment was amplified by RT-PCR using the following primer pair: CCTATGTGTGTGATCTTGAAGG AGATCTGCCTGGCTTTCG For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 454-908 of NM_010924.2 (and contain a single nucleotide mismatch at bp#816), not bp# 529-983 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 454-908 of NM_010924.2 | 2026-07-25 12:47:28 | 0 |
|
pD40-His/V5-c-MycS62A Resource Report Resource Website 1+ mentions |
RRID:Addgene_45599 | c-Myc S62A | Mus musculus | Ampicillin | PMID:15048125 | Alternate plasmid names: pD40-His-c-MycS62A; pcDNA-DEST40 Myc S62A Plasmid construction information: Point mutations were introduced into the murine c-Myc sequence in the CMV–Myc plasmid (Hann et al., Genes Dev. 1994, PMID: 7958908) using the GeneEditor kit (Promega) per manufacturer's instructions using oligonucletide MycS62A, 5′-CACCCCGCCCCTGGCCCCGAGC-3′. The His6-tagged c-MycS62A plasmid was then created by PCR amplification with a CACC 5′ extension added to the 5′ primer for cloning into the TOPO entry clone from Invitrogen (Carlsbad, CA). This sequence was then moved into the pDEST-40 mammalian expression vector using Gateway technology (Invitrogen), creating pD40-His-c-MycS62A. For more plasmid information (map and sequence), see the wildtype version, pD40-His/V5-c-Myc (Addgene plasmid 45597) For additional usage information, see the associated article (Yeh et al. Nat Cell Biol. 2004) as well as Arnold et al. EMBO 2009 (PMID: 19131971). | Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S62A | 2026-07-25 12:47:27 | 2 |
|
pCRII-Topo Chn2 in situ probe Resource Report Resource Website |
RRID:Addgene_45625 | Chn2 in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Chn2 fragment was amplified by RT-PCR using the following primer pair: GCATGAGATTTCCACACCAA TTTCCTTCCATTACACTGTCATAA For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 2212-2619 of BC051139.1 | 2026-07-25 12:47:28 | 0 |
|
pCRII-Topo Epha3 in situ probe Resource Report Resource Website |
RRID:Addgene_45627 | Epha3 in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Epha3 fragment was amplified by RT-PCR using the following primer pair: GTCCAAATGCCTTAAAATGG CAATAGCATTTGGCACTTGG For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 3179-3773 of NM_010140, not bp# 3180-3774 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 3179-3773 of NM_010140 | 2026-07-25 12:47:28 | 0 |
|
pCRII-Topo Hspb3 in situ probe Resource Report Resource Website |
RRID:Addgene_45629 | Hspb3 in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Hspb3 fragment was amplified by RT-PCR using the following primer pair: TGATTCAGCCCCAATTAAGC CTGGGGTATGAAGAGCAACC For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains nt 30-661 of Hspb3 mRNA sequence (BC065388.1) | 2026-07-25 12:47:28 | 0 |
|
pCRII-Topo Cav1 in situ probe Resource Report Resource Website |
RRID:Addgene_45624 | Cav1 in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Cav1 fragment was amplified by RT-PCR using the following primer pair: ACCTCTCTGGACTGGCAGAA AGTGTCGGCAAGACTGAAGG For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the Spe1 restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1472-2124 of AB029929.1, but found single nucleotide mismatches at bp# 1501 & 1574. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 1472-2124 of AB029929.1 | 2026-07-25 12:47:28 | 0 |
|
GFP-CA-mDia1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45583 | Constitutively active mDia1 (CA-mDia1) | Mus musculus | Kanamycin | PMID:23677607 | Backbone Marker:Clontech ; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Insert mDia1 contains mutations V161D and N165D in the N-terminus, and mutations M1182A and L1185A at the C-terminus | 2026-07-25 12:47:27 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
