Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: cdc42
Vector Backbone Description: Backbone Size:4948; Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_12175 Copy
Species: Homo sapiens
Genetic Insert: GPCR activation based ACh sensor GACh2.0
Vector Backbone Description: Backbone Size:4495; Vector Backbone:pAAV vector; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29985477
Proper citation: RRID:Addgene_121921 Copy
Species: Homo sapiens
Genetic Insert: GPCR activation based ACh sensor GRAB-ACh3.0
Vector Backbone Description: Backbone Size:4495; Vector Backbone:pAAV vector; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32989318
Proper citation: RRID:Addgene_121922 Copy
Species: Homo sapiens
Genetic Insert: GPCR activation based ACh sensor GRAB-ACh3.0
Vector Backbone Description: Backbone Size:4495; Vector Backbone:pAAV vector; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32989318
Proper citation: RRID:Addgene_121923 Copy
Species: Homo sapiens
Genetic Insert: p16-INK4A
Vector Backbone Description: Backbone Marker:David Root; Backbone Size:9354; Vector Backbone:pLX401 (pCW57.1, Addgene #41393); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30755442
Comments: p16-INK4A was codon-optimized for synthesis as a gBlock from Integrated DNA Technologies and Gateway cloned into pLX401 (pCW57.1, Addgene #41393).
Proper citation: RRID:Addgene_121919 Copy
Species: Homo sapiens
Genetic Insert: Rac2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14676277
Proper citation: RRID:Addgene_12192 Copy
Species: Homo sapiens
Genetic Insert: Mst1
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pJ3M; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8702870
Proper citation: RRID:Addgene_12204 Copy
Species: Homo sapiens
Genetic Insert: Mst1
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pJ3H; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8702870
Proper citation: RRID:Addgene_12203 Copy
Species: Homo sapiens
Genetic Insert: Mst2
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pJ3H; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8702870
Comments: Addgene's QC finds additional E303D and T342M substitutions which are not known to affect function
Proper citation: RRID:Addgene_12206 Copy
Species: Homo sapiens
Genetic Insert: RECK
Vector Backbone Description: Vector Backbone:pSlick-Neo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29805750
Proper citation: RRID:Addgene_121986 Copy
Species: Homo sapiens
Genetic Insert: DN2Gli3
Vector Backbone Description: Backbone Marker:home made using pCAGGS; Backbone Size:6200; Vector Backbone:Linker A IRES NLS GFP pCAGGS; Vector Types:Mammalian Expression, chick electroporation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15741323
Comments: The GLI3 insert contains an S1131G difference compared to NM_000168.6 that does not affect function.
Proper citation: RRID:Addgene_121970 Copy
Species: Homo sapiens
Genetic Insert: Gli3ZF
Vector Backbone Description: Backbone Marker:home made using pCAGGS; Backbone Size:6200; Vector Backbone:Linker A IRES NLS GFP pCAGGS; Vector Types:Mammalian Expression, chick electroporation; Bacterial Resistance:Ampicillin
Comments: The GLI3 insert contains an S1131G difference compared to NM_000168.6 that does not affect function.
Proper citation: RRID:Addgene_121972 Copy
Species: Homo sapiens
Genetic Insert: BRD4
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30500535
Comments: Vector contains SspB, a bacterial protein which binds exposed SsrA tag (from iLID) at high affinity.
Proper citation: RRID:Addgene_121968 Copy
Species: Homo sapiens
Genetic Insert: DN2Gli3
Vector Backbone Description: Backbone Marker:home made using pCAGGS; Backbone Size:6200; Vector Backbone:Linker A IRES NLS GFP pCAGGS; Vector Types:Mammalian Expression, chick electroporation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15741323
Comments: The GLI3 insert contains an S1131G difference compared to NM_000168.6 that does not affect function.
Proper citation: RRID:Addgene_121969 Copy
Species: Homo sapiens
Genetic Insert: CYFIP1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pmcherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24667445
Proper citation: RRID:Addgene_122051 Copy
Species: Homo sapiens
Genetic Insert: OCT4 - RNAi
Vector Backbone Description: Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15749924
Comments: Target sequence: CATGTGTAAGCTGCGGCCCTT
(NM_002701: bp 642-662)
Proper citation: RRID:Addgene_12198 Copy
Species: Homo sapiens
Genetic Insert: OCT4 - RNAi
Vector Backbone Description: Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15749924
Comments: Target sequence: GGATGTGGTCCGAGTGTGGTT (NM_002701: bp 867-887)
Proper citation: RRID:Addgene_12197 Copy
Species: Homo sapiens
Genetic Insert: RNF125
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_122045 Copy
Species: Homo sapiens
Genetic Insert: Pak1
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pCMV6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9395435
Comments: There is also an additional mutation in this plasmid - L516I. The L516I mutation, or SNP, has been present from the very beginning (~1995). The crystal structure of Pak1 uses this clone, so it is present there too. The depositor does not think it affects function in any way.
Pak1 may contain a G401S mutation. Depositor states that this mutation should not affect plasmid function.
Proper citation: RRID:Addgene_12208 Copy
Species: Homo sapiens
Genetic Insert: Pak1
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pCMV6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8798379
Comments: Pak1 may contain a G401S mutation. Depositor states that this mutation should not affect plasmid function.
Proper citation: RRID:Addgene_12207 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
