Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: EPO
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti6.3/V5-DEST gateway vector; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Human erythropoietin (hEPO) ORF with stop codon (582 bp; Ultimate ORF clone number IOH7334) from GeneCopoeia ORF cDNA clones in pDONR vector (GeneCopoeia; GC-A1011).
Because the stop codon is inserted before V5 epitope, the V5 tag on the pLenti6.3/V5-DEST vector won’t be transcribed.
Proper citation: RRID:Addgene_50436 Copy
Species: Homo sapiens
Genetic Insert: MKK3b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_50450 Copy
Species: Homo sapiens
Genetic Insert: MKK3b
Vector Backbone Description: Backbone Marker:David Baltimore (Addgene Plasmid # 22227); Backbone Size:6034; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_50452 Copy
Species: Homo sapiens
Genetic Insert: hM4D(Gi)-IRES-mCitrine
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
Proper citation: RRID:Addgene_50455 Copy
Species: Homo sapiens
Genetic Insert: hM3D(Gq)-IRES-mCitrine
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
Proper citation: RRID:Addgene_50454 Copy
Species: Homo sapiens
Genetic Insert: hM4D(Gi)-IRES-mCitrine
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
Proper citation: RRID:Addgene_50464 Copy
Species: Homo sapiens
Genetic Insert: hM3D(Gq)-IRES-mCitrine
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
Proper citation: RRID:Addgene_50463 Copy
Species: Homo sapiens
Genetic Insert: hM3D(Gq)-mCherry
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
Proper citation: RRID:Addgene_50460 Copy
Species: Homo sapiens
Genetic Insert: rM3D-IRES-mCitrine
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
Proper citation: RRID:Addgene_50472 Copy
Species: Homo sapiens
Genetic Insert: hM3D(Gq)-IRES-mCitrine
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
Proper citation: RRID:Addgene_50470 Copy
Species: Homo sapiens
Genetic Insert: Paxillin
Vector Backbone Description: Backbone Marker:Yamada lab ; Vector Backbone:pCFP NBC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Vector is a Clontech C1 vector with an MCS modification with original Bam HI mutation
Proper citation: RRID:Addgene_50510 Copy
Species: Homo sapiens
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_50519 Copy
Species: Homo sapiens
Genetic Insert: PXN paxillin
Vector Backbone Description: Backbone Marker:Yamada Lab; Vector Backbone:pmCherry NBC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Replacement of Clontech pEGFP C1 vector EGFP with mCherry and MCS modification with Bam HI mutation of original Bam H I.
Proper citation: RRID:Addgene_50526 Copy
Species: Homo sapiens
Genetic Insert: TRF2
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4378; Vector Backbone:pTrcHisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: This set of TRF2 and TRF2 mutant vectors has been engineered reintroduce Alanine 434, which is deleted in most published TRF2 vectors, and to generate TRF2 and TRF2 mutant proteins with identical N-terminal tags.
Proper citation: RRID:Addgene_50488 Copy
Species: Homo sapiens
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_50520 Copy
Species: Homo sapiens
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_50523 Copy
Species: Homo sapiens
Genetic Insert: Paxillin
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_50529 Copy
Species: Homo sapiens
Genetic Insert: fibronectin
Vector Backbone Description: Vector Backbone:pVC70108; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Primers used for amplification of insert: primer A (CCATATGGGTCGACCCAACTGG), which contains an NdeI site, methionine start codon, and 5' end of the 9th type III repeat sequence, and primer B (ATGAATTCTACATCTGGGATGGTTTGTCAA), which contains an EcoRI site, a stop codon, and the 3' end of the 37-kDa fibronectin fragment.
Proper citation: RRID:Addgene_50495 Copy
Species: Homo sapiens
Genetic Insert: NM_001306129.1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETC'; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_50497 Copy
Species: Homo sapiens
Genetic Insert: fibronectin
Vector Backbone Description: Vector Backbone:pVC70108; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_50496 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.