Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 410 showing 8181 ~ 8200 out of 69,374 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_50436

    This resource has 1+ mentions.

http://www.addgene.org/50436

Species: Homo sapiens
Genetic Insert: EPO
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti6.3/V5-DEST gateway vector; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Human erythropoietin (hEPO) ORF with stop codon (582 bp; Ultimate ORF clone number IOH7334) from GeneCopoeia ORF cDNA clones in pDONR vector (GeneCopoeia; GC-A1011). Because the stop codon is inserted before V5 epitope, the V5 tag on the pLenti6.3/V5-DEST vector won’t be transcribed.

Proper citation: RRID:Addgene_50436 Copy   


http://www.addgene.org/50450

Species: Homo sapiens
Genetic Insert: MKK3b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_50450 Copy   


http://www.addgene.org/50452

Species: Homo sapiens
Genetic Insert: MKK3b
Vector Backbone Description: Backbone Marker:David Baltimore (Addgene Plasmid # 22227); Backbone Size:6034; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_50452 Copy   


http://www.addgene.org/50455

Species: Homo sapiens
Genetic Insert: hM4D(Gi)-IRES-mCitrine
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

Proper citation: RRID:Addgene_50455 Copy   


http://www.addgene.org/50454

Species: Homo sapiens
Genetic Insert: hM3D(Gq)-IRES-mCitrine
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

Proper citation: RRID:Addgene_50454 Copy   


http://www.addgene.org/50464

Species: Homo sapiens
Genetic Insert: hM4D(Gi)-IRES-mCitrine
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

Proper citation: RRID:Addgene_50464 Copy   


http://www.addgene.org/50463

Species: Homo sapiens
Genetic Insert: hM3D(Gq)-IRES-mCitrine
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

Proper citation: RRID:Addgene_50463 Copy   


http://www.addgene.org/50460

Species: Homo sapiens
Genetic Insert: hM3D(Gq)-mCherry
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

Proper citation: RRID:Addgene_50460 Copy   


http://www.addgene.org/50472

Species: Homo sapiens
Genetic Insert: rM3D-IRES-mCitrine
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

Proper citation: RRID:Addgene_50472 Copy   


http://www.addgene.org/50470

Species: Homo sapiens
Genetic Insert: hM3D(Gq)-IRES-mCitrine
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

Proper citation: RRID:Addgene_50470 Copy   


  • RRID:Addgene_50510

http://www.addgene.org/50510

Species: Homo sapiens
Genetic Insert: Paxillin
Vector Backbone Description: Backbone Marker:Yamada lab ; Vector Backbone:pCFP NBC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Vector is a Clontech C1 vector with an MCS modification with original Bam HI mutation

Proper citation: RRID:Addgene_50510 Copy   


  • RRID:Addgene_50519

    This resource has 1+ mentions.

http://www.addgene.org/50519

Species: Homo sapiens
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_50519 Copy   


  • RRID:Addgene_50526

    This resource has 10+ mentions.

http://www.addgene.org/50526

Species: Homo sapiens
Genetic Insert: PXN paxillin
Vector Backbone Description: Backbone Marker:Yamada Lab; Vector Backbone:pmCherry NBC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Replacement of Clontech pEGFP C1 vector EGFP with mCherry and MCS modification with Bam HI mutation of original Bam H I.

Proper citation: RRID:Addgene_50526 Copy   


  • RRID:Addgene_50488

    This resource has 1+ mentions.

http://www.addgene.org/50488

Species: Homo sapiens
Genetic Insert: TRF2
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4378; Vector Backbone:pTrcHisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: This set of TRF2 and TRF2 mutant vectors has been engineered reintroduce Alanine 434, which is deleted in most published TRF2 vectors, and to generate TRF2 and TRF2 mutant proteins with identical N-terminal tags.

Proper citation: RRID:Addgene_50488 Copy   


  • RRID:Addgene_50520

    This resource has 1+ mentions.

http://www.addgene.org/50520

Species: Homo sapiens
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_50520 Copy   


  • RRID:Addgene_50523

http://www.addgene.org/50523

Species: Homo sapiens
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_50523 Copy   


  • RRID:Addgene_50529

    This resource has 1+ mentions.

http://www.addgene.org/50529

Species: Homo sapiens
Genetic Insert: Paxillin
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_50529 Copy   


  • RRID:Addgene_50495

    This resource has 1+ mentions.

http://www.addgene.org/50495

Species: Homo sapiens
Genetic Insert: fibronectin
Vector Backbone Description: Vector Backbone:pVC70108; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Primers used for amplification of insert: primer A (CCATATGGGTCGACCCAACTGG), which contains an NdeI site, methionine start codon, and 5' end of the 9th type III repeat sequence, and primer B (ATGAATTCTACATCTGGGATGGTTTGTCAA), which contains an EcoRI site, a stop codon, and the 3' end of the 37-kDa fibronectin fragment.

Proper citation: RRID:Addgene_50495 Copy   


  • RRID:Addgene_50497

http://www.addgene.org/50497

Species: Homo sapiens
Genetic Insert: NM_001306129.1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETC'; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_50497 Copy   


  • RRID:Addgene_50496

http://www.addgene.org/50496

Species: Homo sapiens
Genetic Insert: fibronectin
Vector Backbone Description: Vector Backbone:pVC70108; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_50496 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X