Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: MKK7g1(K165A)
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_14675 Copy
Species: Mus musculus
Genetic Insert: ZP2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2961; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_14645 Copy
Species: Mus musculus
Genetic Insert: ZP3
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2961; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_14646 Copy
Species: Mus musculus
Genetic Insert: beta-catenin
Vector Backbone Description: Backbone Size:6573; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_14717 Copy
Species: Mus musculus
Genetic Insert: Drosha shRNA
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSUPER.retro.puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: shRNA sequence: GATCCCCTGC CGCAGCAGGT TAATTATTCA AGAGATAATT AACCTGCTGC GGCATTTTTG GAAC
Proper citation: RRID:Addgene_14775 Copy
Species: Mus musculus
Genetic Insert: DGCR8 shRNA
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSUPER.retro.puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: shRNA sequence: GATCCCCCTC TCAATGTGAC TGGATATTCA AGAGATATCC AGTCACATTG AGAGTTTTTG GAAC
Proper citation: RRID:Addgene_14773 Copy
Species: Mus musculus
Genetic Insert: DGCR8 shRNA
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSUPER.retro.puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: shRNA sequence: GATCCCCCCA GTGATGCAGA GGTAATTTCA AGAGAATTAC CTCTGCATCA CTGGTTTTTG GAAC
Proper citation: RRID:Addgene_14774 Copy
Species: Mus musculus
Genetic Insert: DGCR8 shRNA
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSUPER.retro.puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: shRNA sequence: GATCCCCCCA ATGATGACCA AGATTATTCA AGAGATAATC TTGGTCATCA TTGGTTTTTG GAAC
Proper citation: RRID:Addgene_14772 Copy
Species: Mus musculus
Genetic Insert: Luc-m7
Vector Backbone Description: Backbone Marker:Available from Addgene (#12179); Backbone Size:4000; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.
Full sequence of wild-type plasmid available at Addgene plasmid #14785.
Proper citation: RRID:Addgene_14788 Copy
Species: Mus musculus
Genetic Insert: Luc-m2
Vector Backbone Description: Backbone Marker:Available from Addgene (#12179); Backbone Size:4000; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.
Full sequence of wild-type plasmid available at Addgene plasmid #14785.
Proper citation: RRID:Addgene_14786 Copy
Species: Mus musculus
Genetic Insert: Luc-m4
Vector Backbone Description: Backbone Marker:Available from Addgene (#12179); Backbone Size:4000; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.
Full sequence of wild-type plasmid available at Addgene plasmid #14785.
Proper citation: RRID:Addgene_14787 Copy
Species: Mus musculus
Genetic Insert: Smad6
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe puro 3; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: See Author's map for more information.
Proper citation: RRID:Addgene_14835 Copy
Species: Mus musculus
Genetic Insert: Hmga2 ORFtr
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).
Proper citation: RRID:Addgene_14794 Copy
Species: Mus musculus
Genetic Insert: Hmga2 m4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).
Full sequence of wild-type plasmid available at Addgene plasmid #14789.
Proper citation: RRID:Addgene_14791 Copy
Species: Mus musculus
Genetic Insert: K-ras 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4045; Vector Backbone:pRL-TK; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: K-Ras (EMBL accession no. BC004642) mutations
correspond to a series of point mutations (“ACAGTGGAAACC” to “TGAGCGGCCAGG”)
from positions 157 to 168 of the 3’ UTR.
Proper citation: RRID:Addgene_14805 Copy
Species: Mus musculus
Genetic Insert: c-Myc 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4045; Vector Backbone:pRL-TK; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_14806 Copy
Species: Mus musculus
Genetic Insert: PERP promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:pGL3-Basic; Vector Types:Bacterial Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: The pPERPluc1 reporter was constructed by site-directed mutagenesis of the initial ATG of the PERP coding region (to create an NcoI site) using the Quick Change Site Directed mutagenesis kit (Stratagene), followed by joining of the 4-kb PERP promoter region to the initial ATG of luciferase in the pGL3Basic vector (Promega).
Proper citation: RRID:Addgene_14810 Copy
Species: Mus musculus
Genetic Insert: p53 R172H
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Conditional mutant alleles of p53 were generated by introducing the LoxP-flanked transcriptional STOP cassette into intron 1 of the p53 gene. Site-directed mutagenesis was used to introduce an arg→his mutation at codon 172.
Note: This is a large plasmid that can undergo recombination. Bacterial colonies will grow slowly. If there are different colony sizes on a plate, the smaller ones are more likely to contain the correct plasmid.
Proper citation: RRID:Addgene_14854 Copy
Species: Mus musculus
Genetic Insert: Zfp521 promoter - 1 Kb
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: pGL3 backbone is a promoterless vector used for measuring the activity of inserted promoter sequences with a luciferase assay.
Primers used to clone 1Kb Zfp521 promoter:
Forward: cgtttaaaaactattttcttatccaga
Reverse: aatggaaaatccaagcaagg
Proper citation: RRID:Addgene_104188 Copy
Species: Mus musculus
Genetic Insert: ATE1
Vector Backbone Description: Vector Backbone:pH10UE; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Addgene NGS found plasmid contains Ate1 isoform 2 [NM_001271343.1].
Proper citation: RRID:Addgene_104339 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
