Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:homo sapiens (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

69,374 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pGL3-Control-E2F-3'UTR-Mut
 
Resource Report
Resource Website
RRID:Addgene_21171 E2F 3'UTR Mutant Homo sapiens Ampicillin PMID:15944709 Backbone Marker:Promega; Backbone Size:5256; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2 miR binding sites mutated. Changed from GCACTTT to GGAGTGT. 2026-08-01 01:10:03 0
pcDNA-FIH1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21399 HIF1AN Homo sapiens Ampicillin PMID:12615973 Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:10:05 5
TRX1 His C32S C35S
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21286 TRX1 Homo sapiens Ampicillin PMID:12089063 Backbone Size:5400; Vector Backbone:pcDNA3-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin C32S C35S 2026-08-01 01:10:04 2
TRX1 flag C35S
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21285 TRX1 Homo sapiens Ampicillin PMID:12089063 Backbone Size:5400; Vector Backbone:pcDNA3-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin C35S 2026-08-01 01:10:16 4
TRX1 flag C32S
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21284 TRX1 Homo sapiens Ampicillin PMID:12089063 Backbone Size:5400; Vector Backbone:pcDNA3-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin C32S 2026-08-01 01:10:04 3
M-PKD2 (OF2-3)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21370 autosomal dominant polycystic kidney disease type II Homo sapiens Ampicillin PMID:11140688 *Note that this construct has a rare SNP (rs1131408) at position 4:88967820 that results in a missense change (G449V). The polymorphism is not known to affect function. Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wild-type* 2026-08-01 01:10:16 4
pGL3-VEGFR2-225
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21306 VEGFR2 promoter Homo sapiens Ampicillin PMID:19242469 -225 to +268 region of the promoter. Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-01 01:10:04 1
pGL3-VEGFR2-570
 
Resource Report
Resource Website
RRID:Addgene_21309 VEGFR2 promoter Homo sapiens Ampicillin PMID:19242469 -570 to +268 region of the promoter. Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-01 01:10:16 0
CFP-C1-PLCdelta-PH
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21262 PLCdelta Homo sapiens Kanamycin PMID:11134066 Backbone Marker:Clontech; Backbone Size:4701; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin PH domain of PLCdelta (human). Also known as PLCdelta-PH-CFP. Lab plasmid WC0026. 2026-08-01 01:10:04 4
pGL3b(1454/3172)P2P-wt
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21404 EGLN1 Homo sapiens Ampicillin PMID:15563275 Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-01 01:10:05 1
pEGFP-N1-FIH1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21403 HIF1AN Homo sapiens Kanamycin PMID:12615973 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-01 01:10:17 2
WT (REP10)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21368 autosomal dominant polycystic kidney disease type I Homo sapiens Ampicillin PMID:12482949 Please note that Addgene NGS observed a S999P mutation in the PKD1 ORF. The effect of this mutation in unknown. Backbone Marker:Invitrogen; Backbone Size:8500; Vector Backbone:pREP10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:10:05 1
GFP-WT (AF41)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21367 autosomal dominant polycystic kidney disease type I Homo sapiens Ampicillin PMID:12482949 *Please note: during Addgene's quality control process, the following mutations were found in PKD1: A691P, M792L, S999P, N1056T, T1724A, M1976V. The depositor has noted that the plasmid appears to be functional using several assays but it is not the standard PKD1 sequence in the database (Genbank ID L33243). Backbone Marker:Promega; Backbone Size:4713; Vector Backbone:pCI (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wild-type sequence* 2026-08-01 01:10:16 1
E3020X
 
Resource Report
Resource Website
RRID:Addgene_21366 autosomal dominant polycystic kidney disease type I Homo sapiens Ampicillin PMID:12482949 Backbone Marker:Promega; Backbone Size:4713; Vector Backbone:pCI (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Changed E3020 to stop codon 2026-08-01 01:10:05 0
pLKO.1 shMTH1-2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21298 shMTH1-2 Homo sapiens Ampicillin PMID:19118192 shRNA #2 directed against MTH1 sequence 5-GAAATTCCACGGGTACTTCAA-3′. Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:10:16 2
pLKO.1 shMTH1-1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21297 shMTH1-1 Homo sapiens Ampicillin PMID:19118192 shRNA #1 directed against MTH1 sequence 5′-GTGGCTGCTGAACAGCTGCAA-3′. Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:10:04 2
pLKO human shRNA 2 DEPTOR
 
Resource Report
Resource Website
RRID:Addgene_21336 DEPTOR shRNA 2 Homo sapiens Ampicillin PMID:19446321 human DEPTOR shRNA 2 TRC candidate; NM_022783.1-1101s1c1 shRNA oligo sequence - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:10:16 0
pLKO human shRNA 1 DEPTOR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21335 DEPTOR shRNA 1 Homo sapiens Ampicillin PMID:19446321 human DEPTOR shRNA 1 TRC candidate; NM_022783.1-877s1c1 shRNA oligo sequence - 5'-CCGGGCCATGACAATCGGAAATCTACTCGAGTAGATTTCCGATTGTCATGGCTTTTTG Backbone Marker:Available from Addgene (#10878); Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:10:05 1
pBabe puro MTH1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21295 MTH1 Homo sapiens Ampicillin PMID:19118192 The pBabe.puro MTH1 overexpression construct was created by amplifying the MTH1 cDNA from pcDEB.MTH1 (which expresses full-length wild type human MTH1) using PCR primers to add BamHI and EcoRI cloning sites to the 5' and 3' ends respectively, and ligating the resulting fragment into the appropriately digested retroviral pBABE puro vector. Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-01 01:10:16 1
pCDNA3-T7-Keap1
 
Resource Report
Resource Website
RRID:Addgene_21552 kelch-like ECH-associated protein 1 Homo sapiens Ampicillin PMID:15601839 Backbone Marker:Invitrogen; Backbone Size:5407; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:10:18 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.