Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: AL-09 Y32F Y96F
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47083 Copy
Species: Homo sapiens
Genetic Insert: AL-09 Y91F
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47084 Copy
Species: Homo sapiens
Genetic Insert: AL-09
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47081 Copy
Species: Homo sapiens
Genetic Insert: Forkhead Box P2
Vector Backbone Description: Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments:
Proper citation: RRID:Addgene_47053 Copy
Species: Homo sapiens
Genetic Insert: Homeobox A1
Vector Backbone Description: Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments:
Proper citation: RRID:Addgene_47054 Copy
Species: Homo sapiens
Genetic Insert: H2B
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47376 Copy
Species: Homo sapiens
Genetic Insert: Amphiphysin Type I
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Alanine 65 missing
Proper citation: RRID:Addgene_47390 Copy
Species: Homo sapiens
Genetic Insert: Rab35 S22N
Vector Backbone Description: Vector Backbone:pcDNA3-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47429 Copy
Species: Homo sapiens
Genetic Insert: Rab35
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_47424 Copy
Species: Homo sapiens
Genetic Insert: Rab35 Q67L
Vector Backbone Description: Vector Backbone:pcDNA3-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47428 Copy
Species: Homo sapiens
Genetic Insert: Rab35 S22N
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_47426 Copy
Species: Homo sapiens
Genetic Insert: MEK5-DD
Vector Backbone Description: Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments:
Proper citation: RRID:Addgene_47547 Copy
Species: Homo sapiens
Genetic Insert: Vac14
Vector Backbone Description: Backbone Marker:Agilent; Backbone Size:4324; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_47418 Copy
Species: Homo sapiens
Genetic Insert: Intersectin SH3 domain A
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47413 Copy
Species: Homo sapiens
Genetic Insert: cyclin E1
Vector Backbone Description: Backbone Size:6521; Vector Backbone:MIGR1; Vector Types:Mammalian Expression, Retroviral, MSCV-IRES-GFP; Bacterial Resistance:Ampicillin
References:
Comments: Human cyclin E1 (CCNE1) cDNA was mutated at N- and C-terminal Cdc4 phosphodegrons (T62A and T380A, see references) to disrupt interaction with Fbw7 ubiquitin ligase. cDNA is inserted into MIGR1 (MSCV-based retroviral vector), permitting transduction of hematopoietic cells.
Cloned cDNA contains approximately 100 bp from CCNE1 3' UTR.
GFP is co-expressed with cDNA via IRES, permitting enrichment for transduced cells using flow sorting.
References:
Koepp DM, Schaefer LK, Ye X, Keyomarsi K, Chu C, Harper JW et al (2001). Phosphorylation-dependent ubiquitination of cyclin E by the SCFFbw7 ubiquitin ligase. Science 294: 173-177.
Strohmaier H, Spruck CH, Kaiser P, Won KA, Sangfelt O, Reed SI (2001). Human F-box protein hCdc4 targets cyclin E for proteolysis and is mutated in a breast cancer cell line. Nature 413: 316-322.
Proper citation: RRID:Addgene_47498 Copy
Species: Homo sapiens
Genetic Insert: Intersectin SH3 domain D
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47416 Copy
Species: Homo sapiens
Genetic Insert: ITSN1 intersectin 1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47417 Copy
Species: Homo sapiens
Genetic Insert: Intersectin SH3 domain B
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47414 Copy
Species: Homo sapiens
Genetic Insert: gRNA-VEGF site 3
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid #43860); Backbone Size:2278; Vector Backbone:MLM3636; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Target site: GGTGAGTGAGTGTGTGCGTG
gRNA expression vector targeting human VEGF for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9)
Proper citation: RRID:Addgene_47507 Copy
Species: Homo sapiens
Genetic Insert: Glucocorticoid receptor
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_47504 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
