Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pENTR-R4R3-mRuby-N Resource Report Resource Website 1+ mentions |
RRID:Addgene_113752 | mRuby2 | Other | Kanamycin | PMID:31523744 | Second position vector for three-way Gateway LR reaction to insert N-terminal mRuby2 at your locus of interest (stop codon removed). | Backbone Marker:Invitrogen; Backbone Size:2540; Vector Backbone:pDONR221-P4rP3r; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-01 01:00:00 | 1 | |
|
pENTR-R4R3-3xmEGFP-C Resource Report Resource Website 1+ mentions |
RRID:Addgene_113751 | mEGFP-mEGFP-mEGFP | Other | Kanamycin | PMID:31523744 | Second position vector for three-way Gateway LR reaction to insert C-terminal mEGFP-mEGFP-mEGFP at your locus of interest. | Backbone Marker:Invitrogen; Backbone Size:2540; Vector Backbone:pDONR221-P4rP3r; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-01 01:00:00 | 1 | |
|
pGEM-gate Resource Report Resource Website 1+ mentions |
RRID:Addgene_113758 | gateway cassette | Other | Chloramphenicol and Ampicillin | PMID:31523744 | Use this vector for 3-way multi-site Gateway reactions with two regions of homology flanking an insert - this final vector can be used as a template for repair (homology-directed repair) after CRISPR double-strand break. This plasmid was constructed by A-tailing the Gateway cassette (R1R2) and blunt/TA Ligase reaction with pGEM-T Easy to create pGEM-gate. | Backbone Marker:Promega; Backbone Size:3048; Vector Backbone:pGEM-T easy; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-01 01:00:00 | 1 | |
|
pENTR-R4R3-3xmRuby-C Resource Report Resource Website 1+ mentions |
RRID:Addgene_113757 | mRuby2-mRuby2-mRuby2 | Other | Kanamycin | PMID:31523744 | Second position vector for three-way Gateway LR reaction to insert C-terminal mRuby2-mRuby2-mRuby2 at your locus of interest. | Backbone Marker:Invitrogen; Backbone Size:2540; Vector Backbone:pDONR221-P4rP3r; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-01 01:00:00 | 1 | |
|
pENTR-R4R3-2xmRuby-C Resource Report Resource Website 1+ mentions |
RRID:Addgene_113756 | mRuby2-mRuby2 | Other | Kanamycin | PMID:31523744 | Second position vector for three-way Gateway LR reaction to insert C-terminal mRuby2-mRuby2 at your locus of interest. | Backbone Marker:Invitrogen; Backbone Size:2540; Vector Backbone:pDONR221-P4rP3r; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-01 01:00:00 | 1 | |
|
pMK-Cas9-gate Resource Report Resource Website 1+ mentions |
RRID:Addgene_113743 | Cas9 | S. pyogenes, Z. mays | Chloramphenicol and Ampicillin | PMID:31523744 | Also has aminoglycosyl phosphotransferase driven by 35S promoter (G418 resistance). We are not sure of the backbone -- it came from a plasmid that was made many many years ago. It aligns well with pGEM-T Easy (which a lot of our plasmids are based on) so if we had to guess, we would say the backbone is pGEM-T Easy. | Backbone Marker:Promega; Vector Backbone:pGEM-T easy; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-01 01:00:00 | 4 | |
|
pMH-Cas9-gate Resource Report Resource Website 1+ mentions |
RRID:Addgene_113742 | Cas9 | S. pyogenes, Z. mays | Chloramphenicol and Ampicillin | PMID:31523744 | Also has hygromycinR driven by 35S promoter. We are not sure of the backbone -- it came from a plasmid that was made many many years ago. It aligns well with pGEM-T Easy (which a lot of our plasmids are based on) so if we had to guess, we would say the backbone is pGEM-T Easy. | Backbone Marker:Promega; Vector Backbone:pGEM-T easy; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-01 01:00:00 | 3 | |
|
pENTR-PpU6P-sgRNA-L5L4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_113741 | PpU6P::sgRNA | Other | Kanamycin | PMID:31523744 | Backbone Marker:Invitrogen; Backbone Size:2551; Vector Backbone:pDONR221-P5P4; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-01 01:00:00 | 1 | ||
|
pENTR-R4R3-mEGFP-N Resource Report Resource Website 1+ mentions |
RRID:Addgene_113746 | mEGFP | Other | Kanamycin | PMID:31523744 | Second position vector for three-way Gateway LR reaction to insert N-terminal mEGFP at your locus of interest (stop codon removed). | Backbone Marker:Invitrogen; Backbone Size:2540; Vector Backbone:pDONR221-P4rP3r; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-01 01:00:00 | 1 | |
|
pENTR-R4R3-stop Resource Report Resource Website 1+ mentions |
RRID:Addgene_113745 | stop cassette | Synthetic | Kanamycin | PMID:31523744 | Second position vector for three-way Gateway LR reaction to generate a premature stop codon at your locus of interest. Also contains a multiple cloning site for easy genotyping. This plasmid contains multiple M13F and M13R sites, due to cloning the MCS of pBluescriptSK+. QC note: This plasmid dimerizes during growth in bacteria, which can result in digest and Sanger sequencing results that differ from the full plasmid sequence of the monomer. The depositing lab has confirmed that dimerization does not affect plasmid function. | Backbone Marker:Invitrogen; Backbone Size:2540; Vector Backbone:pDONR221-P4rP3r; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin | Added 3 stop codons to the original sequence; see Depositor Comments below | 2026-08-01 01:00:00 | 1 |
|
pZeo-Cas9-gate Resource Report Resource Website 1+ mentions |
RRID:Addgene_113744 | Cas9 | S. pyogenes, Z. mays | Chloramphenicol and Ampicillin | PMID:31523744 | Also has zeocinR driven by 35S promoter. We are not sure of the backbone -- it came from a plasmid that was made many many years ago. It aligns well with pGEM-T Easy (which a lot of our plasmids are based on) so if we had to guess, we would say the backbone is pGEM-T Easy. | Backbone Marker:Promega; Vector Backbone:pGEM-T easy; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-01 01:00:00 | 1 | |
|
pENTR-R4R3-3xmEGFP-N Resource Report Resource Website 1+ mentions |
RRID:Addgene_113748 | mEGFP-mEGFP-mEGFP | Other | Kanamycin | PMID:31523744 | Second position vector for three-way Gateway LR reaction to insert N-terminal mEGFP-mEGFP-mEGFP at your locus of interest (stop codon removed). | Backbone Marker:Invitrogen; Backbone Size:2540; Vector Backbone:pDONR221-P4rP3r; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-01 01:00:00 | 1 | |
|
pJEP314-pAAV-U6SaCas9gRNA(SapI)-CMV-SaCas9-DIO-pA Resource Report Resource Website 1+ mentions |
RRID:Addgene_113691 | SaCas9 | Staphylococcus aureus | Ampicillin | PMID:30483052 | Backbone Marker:Agilent Technologies; Vector Backbone:AAV; Vector Types:AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-01 12:59:59 | 1 | ||
|
pJEP318-pAAV-U6SaCas9gRNA(emx1sg1)-EFS-GFP-KASH-pA Resource Report Resource Website |
RRID:Addgene_113695 | SaCas9 gRNA Cassete | Synthetic | Ampicillin | PMID:30483052 | Backbone Marker:Alligent Technologies; Vector Backbone:AAV; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-01 12:59:59 | 0 | ||
|
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pA Resource Report Resource Website 1+ mentions |
RRID:Addgene_113694 | SaCas9 gRNA Cassete | Synthetic | Ampicillin | PMID:30483052 | Backbone Marker:Alligent Technologies; Vector Backbone:AAV; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-01 12:59:59 | 2 | ||
|
pJEP316-pAAV-U6SaCas9gRNA(SapI)-pA Empty Cassette Resource Report Resource Website |
RRID:Addgene_113693 | SaCas9 gRNA Cassete | Synthetic | Ampicillin | PMID:30483052 | Backbone Marker:Alligent Technologies; Vector Backbone:AAV; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-01 12:59:59 | 0 | ||
|
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA Resource Report Resource Website |
RRID:Addgene_113692 | SaCas9 | Ampicillin | PMID:30483052 | CREB gRNA sequence: GGAGCAGACAACCAGCAGAG | Backbone Marker:Agilent Technologies; Vector Backbone:AAV; Vector Types:Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-01 12:59:59 | 0 | ||
|
pJEP321-pAAV-FullU6TO-SaCas9gRNAi(SapI)-CMV-TetR-P2A-GFP-KASH-WPRE-shortPA Empty Cassette Resource Report Resource Website |
RRID:Addgene_113698 | SaCas9 gRNA Cassete | Synthetic | Ampicillin | PMID:30483052 | The U6TO promoter renders the gRNA inducible via the presence of Doxycycline. See: The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing. de Solis CA, Ho A, Holehonnur R, Ploski JE. Front Mol Neurosci. 2016 Aug 18;9:70. doi: 10.3389/fnmol.2016.00070. eCollection 2016. 10.3389/fnmol.2016.00070 PubMed 27587996 | Backbone Marker:Alligent Technologies; Vector Backbone:AAV; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-01 12:59:59 | 0 | |
|
pCDF1-MCS2-EF1-Puro-RGS7-E383K Resource Report Resource Website |
RRID:Addgene_113731 | RGS7 | Homo sapiens | Ampicillin | PMID:29330521 | Backbone Size:6583; Vector Backbone:PCDF1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | E383K | 2026-08-01 01:00:00 | 0 | |
|
pJEP320-pAAV-U6SaCas9gRNA(CREB3)_EFS-GFP-KASH-pA Resource Report Resource Website |
RRID:Addgene_113697 | SaCas9 gRNA Cassete | Synthetic | Ampicillin | PMID:30483052 | Backbone Marker:Alligent Technologies; Vector Backbone:AAV; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-01 12:59:59 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
