Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: mRuby2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2540; Vector Backbone:pDONR221-P4rP3r; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31523744
Comments: Second position vector for three-way Gateway LR reaction to insert N-terminal mRuby2 at your locus of interest (stop codon removed).
Proper citation: RRID:Addgene_113752 Copy
Species: Other
Genetic Insert: mEGFP-mEGFP-mEGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2540; Vector Backbone:pDONR221-P4rP3r; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31523744
Comments: Second position vector for three-way Gateway LR reaction to insert C-terminal mEGFP-mEGFP-mEGFP at your locus of interest.
Proper citation: RRID:Addgene_113751 Copy
Species: Other
Genetic Insert: gateway cassette
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3048; Vector Backbone:pGEM-T easy; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31523744
Comments: Use this vector for 3-way multi-site Gateway reactions with two regions of homology flanking an insert - this final vector can be used as a template for repair (homology-directed repair) after CRISPR double-strand break. This plasmid was constructed by A-tailing the Gateway cassette (R1R2) and blunt/TA Ligase reaction with pGEM-T Easy to create pGEM-gate.
Proper citation: RRID:Addgene_113758 Copy
Species: Other
Genetic Insert: mRuby2-mRuby2-mRuby2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2540; Vector Backbone:pDONR221-P4rP3r; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31523744
Comments: Second position vector for three-way Gateway LR reaction to insert C-terminal mRuby2-mRuby2-mRuby2 at your locus of interest.
Proper citation: RRID:Addgene_113757 Copy
Species: Other
Genetic Insert: mRuby2-mRuby2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2540; Vector Backbone:pDONR221-P4rP3r; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31523744
Comments: Second position vector for three-way Gateway LR reaction to insert C-terminal mRuby2-mRuby2 at your locus of interest.
Proper citation: RRID:Addgene_113756 Copy
Species: S. pyogenes, Z. mays
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGEM-T easy; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31523744
Comments: Also has aminoglycosyl phosphotransferase driven by 35S promoter (G418 resistance). We are not sure of the backbone -- it came from a plasmid that was made many many years ago. It aligns well with pGEM-T Easy (which a lot of our plasmids are based on) so if we had to guess, we would say the backbone is pGEM-T Easy.
Proper citation: RRID:Addgene_113743 Copy
Species: S. pyogenes, Z. mays
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGEM-T easy; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31523744
Comments: Also has hygromycinR driven by 35S promoter. We are not sure of the backbone -- it came from a plasmid that was made many many years ago. It aligns well with pGEM-T Easy (which a lot of our plasmids are based on) so if we had to guess, we would say the backbone is pGEM-T Easy.
Proper citation: RRID:Addgene_113742 Copy
Species: Other
Genetic Insert: PpU6P::sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2551; Vector Backbone:pDONR221-P5P4; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31523744
Proper citation: RRID:Addgene_113741 Copy
Species: Other
Genetic Insert: mEGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2540; Vector Backbone:pDONR221-P4rP3r; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31523744
Comments: Second position vector for three-way Gateway LR reaction to insert N-terminal mEGFP at your locus of interest (stop codon removed).
Proper citation: RRID:Addgene_113746 Copy
Species: Synthetic
Genetic Insert: stop cassette
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2540; Vector Backbone:pDONR221-P4rP3r; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31523744
Comments: Second position vector for three-way Gateway LR reaction to generate a premature stop codon at your locus of interest. Also contains a multiple cloning site for easy genotyping. This plasmid contains multiple M13F and M13R sites, due to cloning the MCS of pBluescriptSK+.
QC note: This plasmid dimerizes during growth in bacteria, which can result in digest and Sanger sequencing results that differ from the full plasmid sequence of the monomer. The depositing lab has confirmed that dimerization does not affect plasmid function.
Proper citation: RRID:Addgene_113745 Copy
Species: S. pyogenes, Z. mays
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGEM-T easy; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31523744
Comments: Also has zeocinR driven by 35S promoter. We are not sure of the backbone -- it came from a plasmid that was made many many years ago. It aligns well with pGEM-T Easy (which a lot of our plasmids are based on) so if we had to guess, we would say the backbone is pGEM-T Easy.
Proper citation: RRID:Addgene_113744 Copy
Species: Other
Genetic Insert: mEGFP-mEGFP-mEGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2540; Vector Backbone:pDONR221-P4rP3r; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31523744
Comments: Second position vector for three-way Gateway LR reaction to insert N-terminal mEGFP-mEGFP-mEGFP at your locus of interest (stop codon removed).
Proper citation: RRID:Addgene_113748 Copy
Species: Staphylococcus aureus
Genetic Insert: SaCas9
Vector Backbone Description: Backbone Marker:Agilent Technologies; Vector Backbone:AAV; Vector Types:AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30483052
Proper citation: RRID:Addgene_113691 Copy
Species: Synthetic
Genetic Insert: SaCas9 gRNA Cassete
Vector Backbone Description: Backbone Marker:Alligent Technologies; Vector Backbone:AAV; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30483052
Proper citation: RRID:Addgene_113695 Copy
Species: Synthetic
Genetic Insert: SaCas9 gRNA Cassete
Vector Backbone Description: Backbone Marker:Alligent Technologies; Vector Backbone:AAV; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30483052
Proper citation: RRID:Addgene_113694 Copy
Species: Synthetic
Genetic Insert: SaCas9 gRNA Cassete
Vector Backbone Description: Backbone Marker:Alligent Technologies; Vector Backbone:AAV; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30483052
Proper citation: RRID:Addgene_113693 Copy
Genetic Insert: SaCas9
Vector Backbone Description: Backbone Marker:Agilent Technologies; Vector Backbone:AAV; Vector Types:Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30483052
Comments: CREB gRNA sequence: GGAGCAGACAACCAGCAGAG
Proper citation: RRID:Addgene_113692 Copy
Species: Synthetic
Genetic Insert: SaCas9 gRNA Cassete
Vector Backbone Description: Backbone Marker:Alligent Technologies; Vector Backbone:AAV; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30483052
Comments: The U6TO promoter renders the gRNA inducible via the presence of Doxycycline. See: The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing. de Solis CA, Ho A, Holehonnur R, Ploski JE. Front Mol Neurosci. 2016 Aug 18;9:70. doi: 10.3389/fnmol.2016.00070. eCollection 2016. 10.3389/fnmol.2016.00070 PubMed 27587996
Proper citation: RRID:Addgene_113698 Copy
Species: Homo sapiens
Genetic Insert: RGS7
Vector Backbone Description: Backbone Size:6583; Vector Backbone:PCDF1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29330521
Proper citation: RRID:Addgene_113731 Copy
Species: Synthetic
Genetic Insert: SaCas9 gRNA Cassete
Vector Backbone Description: Backbone Marker:Alligent Technologies; Vector Backbone:AAV; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30483052
Proper citation: RRID:Addgene_113697 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.