Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 40 showing 781 ~ 800 out of 739,423 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_177461

http://www.addgene.org/177461

Species: Mus musculus
Genetic Insert: anti-NPY/Neuropeptide Y (Homo sapiens) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2877570. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_177461 Copy   


  • RRID:Addgene_177339

http://www.addgene.org/177339

Species: Caenorhabditis elegans
Genetic Insert: Pmyo-3::mNeonGreen
Vector Backbone Description: Backbone Size:2445; Vector Backbone:N/A; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37396790
Comments: C. elegans codon-optimized mNeonGreen. Use as an array marker for CRISPR or as a general co-injection marker. Very bright mNG fluorescence in body wall muscle. Inject at 5 ng/uL. Made by George Huang (Glow Worms '20). pGLOW79 has 10 random mutations relative to the pCFJ104 backbone that do not affect plasmid function.

Proper citation: RRID:Addgene_177339 Copy   


  • RRID:Addgene_177453

http://www.addgene.org/177453

Species: Mus musculus
Genetic Insert: anti-VIP (Homo sapiens) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2877573. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_177453 Copy   


http://www.addgene.org/177452

Species: Mus musculus
Genetic Insert: anti-Neuroligin-2 (Mus musculus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2877595. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_177452 Copy   


http://www.addgene.org/177455

Species: Mus musculus
Genetic Insert: anti-Calbindin (Homo sapiens) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2877197. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_177455 Copy   


  • RRID:Addgene_177336

    This resource has 1+ mentions.

http://www.addgene.org/177336

Species: Hyphochytrium catenoides
Genetic Insert: HcKCR1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35726059

Proper citation: RRID:Addgene_177336 Copy   


http://www.addgene.org/177335

Species: SARS-CoV-2 virus
Genetic Insert: SARS-CoV-2 3C-like (C145A) proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET21b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34672947
Comments: Silent mutation in the original sequence to delete a second NdeI site as NdeI was needed for cloning; codon coding for Q306 was mutated to codon coding for A306 to delete natural cleavage site of the 3CL-protease; codon coding for active site residue C145 was mutated to A145 for inactive protease production; Factor Xa cleavage site can cleave off all 3 downstream tags; three tandem FLAG epitope tags is followed by an enterokinase cleavage site.

Proper citation: RRID:Addgene_177335 Copy   


  • RRID:Addgene_177338

    This resource has 1+ mentions.

http://www.addgene.org/177338

Species: Caenorhabditis elegans
Genetic Insert: Pmyo-2::mNeonGreen
Vector Backbone Description: Backbone Size:2445; Vector Backbone:N/A; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37396790
Comments: C. elegans codon-optimized mNeonGreen. Use as an array marker for CRISPR or as a general co-injection marker. Very bright mNG fluorescence in pharyngeal muscle. Inject at 2.5 ng/uL. Made by George Huang (Glow Worms '20). pGLOW77 has 11 random mutations relative to the pCFJ90 backbone that do not affect plasmid function.

Proper citation: RRID:Addgene_177338 Copy   


http://www.addgene.org/177459

Species: Mus musculus
Genetic Insert: anti-Parvalbumin (Rattus norvegicus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2877608. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_177459 Copy   


http://www.addgene.org/177458

Species: Mus musculus
Genetic Insert: anti-Homer1L (Mus musculus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2877572. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_177458 Copy   


http://www.addgene.org/177330

Species: Homo sapiens
Genetic Insert: Cyclin-dependent kinase 1
Vector Backbone Description: Backbone Size:5334; Vector Backbone:pF1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34290405
Comments: Genes are gene-optimised for insect cell expression and have been ordered from GeneArts.

Proper citation: RRID:Addgene_177330 Copy   


  • RRID:Addgene_177369

http://www.addgene.org/177369

Genetic Insert: sfGFP
Vector Backbone Description: Vector Backbone:Empty backbone; Vector Types:Synthetic Biology, Cell-Free Protein Synthesis; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:35034449

Proper citation: RRID:Addgene_177369 Copy   


  • RRID:Addgene_177474

    This resource has 1+ mentions.

http://www.addgene.org/177474

Species: Mus musculus
Genetic Insert: anti-GAD65/67 (Homo sapiens) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2756510. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_177474 Copy   


http://www.addgene.org/177471

Species: Mus musculus
Genetic Insert: anti-Synapsin-3 (Homo sapiens) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2725817. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_177471 Copy   


  • RRID:Addgene_1977

    This resource has 1+ mentions.

http://www.addgene.org/1977

Species: Mus musculus
Genetic Insert: RASSF1C
Vector Backbone Description: Backbone Size:4657; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11857081

Proper citation: RRID:Addgene_1977 Copy   


  • RRID:Addgene_19757

    This resource has 1+ mentions.

http://www.addgene.org/19757

Species: Homo sapiens
Genetic Insert: Orai1
Vector Backbone Description: Backbone Size:0; Vector Backbone:EGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16921383

Proper citation: RRID:Addgene_19757 Copy   


  • RRID:Addgene_19758

    This resource has 1+ mentions.

http://www.addgene.org/19758

Species: Homo sapiens
Genetic Insert: cyclin-dependent kinase 8
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18794900

Proper citation: RRID:Addgene_19758 Copy   


  • RRID:Addgene_19809

http://www.addgene.org/19809

Genetic Insert: shRNA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18840295
Comments: Target sequence for shR-E2-1 - 5'-GTGCAATGCTGACGACTTTCAAT

Proper citation: RRID:Addgene_19809 Copy   


  • RRID:Addgene_19808

http://www.addgene.org/19808

Genetic Insert: shRNA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18840295
Comments: Target sequence for shR-E1-8 - 5'-GCATCGTATATGAGACCTTCCAT

Proper citation: RRID:Addgene_19808 Copy   


  • RRID:Addgene_19762

    This resource has 1+ mentions.

http://www.addgene.org/19762

Species: Homo sapiens
Genetic Insert: small hairpin RNA against beta-catenin
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18794900
Comments: 2279 refers to the shRNA clone name from the RNAi Consortium at the Broad Institute and indicates the location on the CTNNB1 mRNA that is targeted. shRNA sequence for 2279 is: CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTT

Proper citation: RRID:Addgene_19762 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X