Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: DJ1
Vector Backbone Description: Backbone Size:4756; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15663963
Proper citation: RRID:Addgene_29396 Copy
Species: Gallus gallus
Genetic Insert: AP-SEMA3C
Vector Backbone Description: Backbone Marker:modified from PCDNA3 see methods in associated publication.; Backbone Size:6000; Vector Backbone:pAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9331347
Proper citation: RRID:Addgene_29449 Copy
Species: Gallus gallus
Genetic Insert: AP-SEMA3A (chick)
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9331347
Proper citation: RRID:Addgene_29448 Copy
Species: Homo sapiens
Genetic Insert: ERG
Vector Backbone Description: Backbone Marker:Amaxa; Backbone Size:2800; Vector Backbone:pMAX-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18245377
Comments: PCR fragment amplified using IMAGE clone 6052140. Cloned into pCR8/GW/TOPO and then moved to pMAX-DEST using Gateway.
For transient expression of human deltaN-ERG. Has endogenous stop codon (no V5).
Proper citation: RRID:Addgene_29447 Copy
Species: Homo sapiens
Genetic Insert: INO80
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5070; Vector Backbone:pcDNA5-FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21303910
Proper citation: RRID:Addgene_29442 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SUP45 gene encoding translation release factor 1 from S. cerevisiae
Vector Backbone Description: Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20444877
Proper citation: RRID:Addgene_29383 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SUP45 gene encoding translation release factor 1 from S. cerevisiae
Vector Backbone Description: Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20444877
Proper citation: RRID:Addgene_29382 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SUP45 gene encoding translation release factor 1 from S. cerevisiae
Vector Backbone Description: Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20444877
Proper citation: RRID:Addgene_29381 Copy
Species: Homo sapiens
Genetic Insert: DJ1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_29419 Copy
Species: Homo sapiens
Genetic Insert: DJ1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_29417 Copy
Species: Homo sapiens
Genetic Insert: DJ1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_29415 Copy
Species: Homo sapiens
Genetic Insert: DJ1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_29413 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SUP45 gene encoding translation release factor 1 from S. cerevisiae
Vector Backbone Description: Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20444877
Proper citation: RRID:Addgene_29379 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SUP45 gene encoding translation release factor 1 from S. cerevisiae
Vector Backbone Description: Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20444877
Proper citation: RRID:Addgene_29376 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SUP45 gene encoding translation release factor 1 from S. cerevisiae
Vector Backbone Description: Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20444877
Proper citation: RRID:Addgene_29373 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SUP45 gene encoding translation release factor 1 from S. cerevisiae
Vector Backbone Description: Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20444877
Proper citation: RRID:Addgene_29394 Copy
Species: Mus musculus
Genetic Insert: Venus CAM KII Alpha
Vector Backbone Description: Backbone Size:3984; Vector Backbone:pEGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19339497
Proper citation: RRID:Addgene_29429 Copy
Species: Mus musculus
Genetic Insert: Venus CamKII alpha
Vector Backbone Description: Backbone Size:3984; Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19339497
Proper citation: RRID:Addgene_29427 Copy
Genetic Insert: Venus-5-Venus-5-Venus-5-Venus-5-Venus
Vector Backbone Description: Backbone Size:3984; Vector Backbone:pEGFP C1; Vector Types:Mammalian Expression, Anisotropy and brightness standard; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19339497
Comments: Anisotropy standard and brightness standard
The 1st Venus can be excised using a NheI-BSP E1 double digest; the 2nd Venus by BSP E1-BglII; the 3rd Venus by BglII-EcoRI; the 4th Venus by EcoRI-EcoRV; the last (5th) Venus by SalI-BamHI. The full insert can be released by a NheI-BamHI double-digest.
Due to the multiple Venus repeats in this plasmid, Addgene is unable to confirm the entire insert by sequencing. Please see Addgene's diagnostic digest for this plasmid by clicking the Notes from Addgene link above.
Proper citation: RRID:Addgene_29426 Copy
Genetic Insert: Venus-17-Venus
Vector Backbone Description: Backbone Size:3984; Vector Backbone:pEGFP C1; Vector Types:Mammalian Expression, Anisotropy and brightness standard; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19339497
Comments: Anisotropy standard and brightness standard
Linker sequence: TCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACGGTACCAGCAAGG
Proper citation: RRID:Addgene_29424 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
