Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: ZF1 domain from pie-1
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pBR322; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_59790 Copy
Species: Caenorhabditis elegans
Genetic Insert: rde-1(D718) gRNA
Vector Backbone Description: Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_59927 Copy
Species: Caenorhabditis elegans
Genetic Insert: dhc-3
Vector Backbone Description: Backbone Marker:Andrew Fire; Backbone Size:2790; Vector Backbone:L4440; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Source BioScience LifeSciences C. elegans RNAi library clones utilized in plasmid construction (Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000) Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325–330.)
Proper citation: RRID:Addgene_59997 Copy
Species: Caenorhabditis elegans
Genetic Insert: dhc-3
Vector Backbone Description: Backbone Marker:Andrew Fire; Backbone Size:2790; Vector Backbone:L4440; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Source BioScience LifeSciences C. elegans RNAi library clones utilized in plasmid construction (Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000) Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325–330.)
Proper citation: RRID:Addgene_59996 Copy
Species: Caenorhabditis elegans
Genetic Insert: sqt-1(e1350) gRNA1
Vector Backbone Description: Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_60212 Copy
Species: Caenorhabditis elegans
Genetic Insert: Peft-3::gfp::h2b::tbb-2 3'UTR
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:2710; Vector Backbone:pUC57; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_65631 Copy
Species: Caenorhabditis elegans
Genetic Insert: sgRNA for APs12
Vector Backbone Description: Backbone Marker:Goldstein lab Plasmid 47549; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: From the depositor: Each positive clones had been sequenced for correct insertion of the sgRNA . However the PCR could have created some mutation in the plasmid backbone (containing also the Cas9 gene) and we didnt sequenced the full plasmid, therefore we recommend to use a mix of several positive clones. It is why we provide several clones containing the same sgRNA insert.
Proper citation: RRID:Addgene_65597 Copy
Species: Caenorhabditis elegans
Genetic Insert: Peft-3::gfp::h2b::tbb-2 3'UTR, C. briggsae unc-119 rescue fragment
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:2710; Vector Backbone:pUC57; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_65632 Copy
Species: Caenorhabditis elegans
Genetic Insert: sgRNA for APa13
Vector Backbone Description: Backbone Marker:Goldstein lab Plasmid 47549; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: From the depositor: Each positive clones had been sequenced for correct insertion of the sgRNA . However the PCR could have created some mutation in the plasmid backbone (containing also the Cas9 gene) and we didnt sequenced the full plasmid, therefore we recommend to use a mix of several positive clones. It is why we provide several clones containing the same sgRNA insert.
Proper citation: RRID:Addgene_65594 Copy
Species: Caenorhabditis elegans
Genetic Insert: sgRNA for APa13
Vector Backbone Description: Backbone Marker:Goldstein lab Plasmid 47549; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: From the depositor: Each positive clones had been sequenced for correct insertion of the sgRNA . However the PCR could have created some mutation in the plasmid backbone (containing also the Cas9 gene) and we didnt sequenced the full plasmid, therefore we recommend to use a mix of several positive clones. It is why we provide several clones containing the same sgRNA insert.
Proper citation: RRID:Addgene_65593 Copy
Species: Caenorhabditis elegans
Genetic Insert: sgRNA for APa13
Vector Backbone Description: Backbone Marker:Goldstein lab Plasmid 47549; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: From the depositor: Each positive clones had been sequenced for correct insertion of the sgRNA . However the PCR could have created some mutation in the plasmid backbone (containing also the Cas9 gene) and we didnt sequenced the full plasmid, therefore we recommend to use a mix of several positive clones. It is why we provide several clones containing the same sgRNA insert.
Proper citation: RRID:Addgene_65596 Copy
Species: Caenorhabditis elegans
Genetic Insert: NLG-1
Vector Backbone Description: Backbone Marker:C.Bargmann; Backbone Size:3500; Vector Backbone:pSM; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_65827 Copy
Species: Caenorhabditis elegans
Genetic Insert: Chrimson
Vector Backbone Description: Vector Backbone:pUC57-Kan; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
References:
Comments: This construct was produced through de novo gene synthesis.
Chrimson amino acid sequence was published in: Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, Wang J, Xie Y, Yan Z, Zhang Y, Chow BY, Surek B, Melkonian M, Jayaraman V, Constantine-Paton M, Wong GK, and Boyden ES. 2014. Independent optical excitation of distinct neural populations. Nat. Meth. 11, 338-346.
Proper citation: RRID:Addgene_66101 Copy
Species: Caenorhabditis elegans
Genetic Insert: Chronos
Vector Backbone Description: Vector Backbone:pUC57-Kan; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
References:
Comments: This construct was produced through de novo gene synthesis.
Chronos amino acid sequence was published in: Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, Wang J, Xie Y, Yan Z, Zhang Y, Chow BY, Surek B, Melkonian M, Jayaraman V, Constantine-Paton M, Wong GK, and Boyden ES. 2014. Independent optical excitation of distinct neural populations. Nat. Meth. 11, 338-346.
Proper citation: RRID:Addgene_66102 Copy
Species: Caenorhabditis elegans
Genetic Insert: avr-15 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
References:
Comments: gRNA target sequence GTTTGCAATATAAGTCACCC
Proper citation: RRID:Addgene_58982 Copy
Species: Caenorhabditis elegans
Genetic Insert: avr-14 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
References:
Comments: gRNA target sequence GATTGGAGAGTTAGACCACG
Proper citation: RRID:Addgene_58981 Copy
Species: Caenorhabditis elegans
Genetic Insert: Blasticidin S resistance
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:1961; Vector Backbone:pBluescript KS(+); Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_59181 Copy
Species: Caenorhabditis elegans
Genetic Insert: rab-3::NLS::GCaMP6s
Vector Backbone Description: Vector Backbone:Not Available; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_68119 Copy
Species: Caenorhabditis elegans
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Erik Jorgensen; Backbone Size:7606; Vector Backbone:pCFJ356; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_69149 Copy
Species: Caenorhabditis elegans
Genetic Insert: TagBFP2
Vector Backbone Description: Backbone Marker:Andrew Fire; Backbone Size:3417; Vector Backbone:pPD49_26; Vector Types:Worm Expression, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_69259 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
