Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

745,319 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pRK5-mouse-DJ1-HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_29396 DJ1 Mus musculus Ampicillin PMID:15663963 Backbone Size:4756; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:33 6
AP-SEMA3C (chick)
 
Resource Report
Resource Website 		RRID:Addgene_29449 AP-SEMA3C Gallus gallus Ampicillin PMID:9331347 Backbone Marker:modified from PCDNA3 see methods in associated publication.; Backbone Size:6000; Vector Backbone:pAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:34 0
AP-SEMA3A (chick)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_29448 AP-SEMA3A (chick) Gallus gallus Ampicillin PMID:9331347 Backbone Size:6000; Vector Backbone:pAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:34 3
pMAX deltaN-ERG
 
Resource Report
Resource Website 		RRID:Addgene_29447 ERG Homo sapiens Kanamycin PMID:18245377 PCR fragment amplified using IMAGE clone 6052140. Cloned into pCR8/GW/TOPO and then moved to pMAX-DEST using Gateway. For transient expression of human deltaN-ERG. Has endogenous stop codon (no V5). Backbone Marker:Amaxa; Backbone Size:2800; Vector Backbone:pMAX-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Deletion of first 33 aa of ERG Addgene 2026-11-07 01:13:34 0
pcDNA5FRT/Flag-hINO80N2 (1-406)
 
Resource Report
Resource Website 		RRID:Addgene_29442 INO80 Homo sapiens Ampicillin PMID:21303910 Backbone Marker:Invitrogen; Backbone Size:5070; Vector Backbone:pcDNA5-FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin INO80 1-406 (a.a.) Addgene 2026-11-07 01:13:34 0
pTH375-SUP45-P174Q
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_29383 SUP45 gene encoding translation release factor 1 from S. cerevisiae Saccharomyces cerevisiae Ampicillin PMID:20444877 Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin P174Q mutant gene including genomic sequence 1432 bp upstream of AUG and 241 bp downstream of stop codon. Addgene 2026-11-07 01:13:33 1
pTH627-SUP45-V107D
 
Resource Report
Resource Website 		RRID:Addgene_29382 SUP45 gene encoding translation release factor 1 from S. cerevisiae Saccharomyces cerevisiae Ampicillin PMID:20444877 Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin V107D mutant gene including genomic sequence 1432 bp upstream of AUG and 241 bp downstream of stop codon. Addgene 2026-11-07 01:13:33 0
pTH401-SUP45-R65C
 
Resource Report
Resource Website 		RRID:Addgene_29381 SUP45 gene encoding translation release factor 1 from S. cerevisiae Saccharomyces cerevisiae Ampicillin PMID:20444877 Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin R65C mutant gene (corresponding to the sup45-3 allele) including genomic sequence 1432 bp upstream of AUG and 241 bp downstream of stop codon. Addgene 2026-11-07 01:13:33 0
pLenti6-DJ1-V5-C53A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_29419 DJ1 Homo sapiens Ampicillin Backbone Marker:Invitrogen; Backbone Size:9000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Cys53Ala Addgene 2026-11-07 01:13:33 1
pLenti6-DJ1-V5-E18Q
 
Resource Report
Resource Website 		RRID:Addgene_29417 DJ1 Homo sapiens Ampicillin Backbone Marker:Invitrogen; Backbone Size:9000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Glu18Gln Addgene 2026-11-07 01:13:33 0
pLenti6-DJ1-V5-E18D
 
Resource Report
Resource Website 		RRID:Addgene_29415 DJ1 Homo sapiens Ampicillin Backbone Marker:Invitrogen; Backbone Size:9000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Glu18Asp Addgene 2026-11-07 01:13:33 0
pLenti6-DJ1-V5-C106D
 
Resource Report
Resource Website 		RRID:Addgene_29413 DJ1 Homo sapiens Ampicillin Backbone Marker:Invitrogen; Backbone Size:9000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Cys106Asp Addgene 2026-11-07 01:13:33 0
pTH372-SUP45-K60A
 
Resource Report
Resource Website 		RRID:Addgene_29379 SUP45 gene encoding translation release factor 1 from S. cerevisiae Saccharomyces cerevisiae Ampicillin PMID:20444877 Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin K60A mutant gene including genomic sequence 1432 bp upstream of AUG and 241 bp downstream of stop codon. Addgene 2026-11-07 01:13:33 0
pTH398-SUP45-G54D
 
Resource Report
Resource Website 		RRID:Addgene_29376 SUP45 gene encoding translation release factor 1 from S. cerevisiae Saccharomyces cerevisiae Ampicillin PMID:20444877 Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin G54D mutant gene including genomic sequence 1432 bp upstream of AUG and 241 bp downstream of stop codon. Addgene 2026-11-07 01:13:33 0
pTH394-SUP45-L34S
 
Resource Report
Resource Website 		RRID:Addgene_29373 SUP45 gene encoding translation release factor 1 from S. cerevisiae Saccharomyces cerevisiae Ampicillin PMID:20444877 Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin L34S mutant gene (corresponding to the sup45-36ts allele) including genomic sequence 1432 bp upstream of AUG and 241 bp downstream of stop codon. Addgene 2026-11-07 01:13:33 0
pTH363-SUP45-F401Y
 
Resource Report
Resource Website 		RRID:Addgene_29394 SUP45 gene encoding translation release factor 1 from S. cerevisiae Saccharomyces cerevisiae Ampicillin PMID:20444877 Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin F401Y mutant gene including genomic sequence 1432 bp upstream of AUG and 241 bp downstream of stop codon. Addgene 2026-11-07 01:13:33 0
Venus Cam KII alpha mutant T286D
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_29429 Venus CAM KII Alpha Mus musculus Kanamycin PMID:19339497 Backbone Size:3984; Vector Backbone:pEGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin T286D mutation in CamKIIa sequence Addgene 2026-11-07 01:13:33 1
CamKII alpha Venus
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_29427 Venus CamKII alpha Mus musculus Kanamycin PMID:19339497 Backbone Size:3984; Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-11-07 01:13:33 5
VVVVV
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_29426 Venus-5-Venus-5-Venus-5-Venus-5-Venus Kanamycin PMID:19339497 Anisotropy standard and brightness standard The 1st Venus can be excised using a NheI-BSP E1 double digest; the 2nd Venus by BSP E1-BglII; the 3rd Venus by BglII-EcoRI; the 4th Venus by EcoRI-EcoRV; the last (5th) Venus by SalI-BamHI. The full insert can be released by a NheI-BamHI double-digest. Due to the multiple Venus repeats in this plasmid, Addgene is unable to confirm the entire insert by sequencing. Please see Addgene's diagnostic digest for this plasmid by clicking the Notes from Addgene link above. Backbone Size:3984; Vector Backbone:pEGFP C1; Vector Types:Mammalian Expression, Anisotropy and brightness standard; Bacterial Resistance:Kanamycin Addgene 2026-11-07 01:13:33 2
V17V
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_29424 Venus-17-Venus Kanamycin PMID:19339497 Anisotropy standard and brightness standard Linker sequence: TCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACGGTACCAGCAAGG Backbone Size:3984; Vector Backbone:pEGFP C1; Vector Types:Mammalian Expression, Anisotropy and brightness standard; Bacterial Resistance:Kanamycin Addgene 2026-11-07 01:13:33 3

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch