Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Park2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4698; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_46924 Copy
Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_46929 Copy
Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5200; Vector Backbone:pIRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: A 5' EcoRI site and 3' myc tag were added to the FJX1 cDNA by PCR. The fragment was blunt end ligated into an EcoRV site on pIRES-EGFP so there is an additional EcoRI site at 5' end of FJX1.
Proper citation: RRID:Addgene_46928 Copy
Species: Homo sapiens
Genetic Insert: Uracil-N-glycosylase WT
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:6686; Vector Backbone:pMA2780; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_46885 Copy
Species: Homo sapiens
Genetic Insert: dCas9-p65AD-BFP fusion
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:MSCV-puro; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_46913 Copy
Species: Homo sapiens
Genetic Insert: sgCD71 -2
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: gRNA target sequence GGACGCGCTAGTGTGAGTGC
Proper citation: RRID:Addgene_46918 Copy
Species: Homo sapiens
Genetic Insert: Tau E14 P301L
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14.
Proper citation: RRID:Addgene_46909 Copy
Species: Homo sapiens
Genetic Insert: Tau E14
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14.
Proper citation: RRID:Addgene_46907 Copy
Species: Homo sapiens
Genetic Insert: Tau AP P301L
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14.
Proper citation: RRID:Addgene_46906 Copy
Species: Homo sapiens
Genetic Insert: Triple MBT domain from human L3MBTL1
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Original description of the plasmid in West et al. J Biol Chem. 2010 Nov 26;285(48):37725-32.
Proper citation: RRID:Addgene_46987 Copy
Species: Homo sapiens
Genetic Insert: DAH
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47096 Copy
Species: Homo sapiens
Genetic Insert: HAL
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47097 Copy
Species: Homo sapiens
Genetic Insert: AL-103 Y96F
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47094 Copy
Species: Homo sapiens
Genetic Insert: AL-103 delProIns
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47095 Copy
Species: Homo sapiens
Genetic Insert: JOH1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47098 Copy
Species: Homo sapiens
Genetic Insert: AL-103 Y32F Y96F
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47092 Copy
Species: Homo sapiens
Genetic Insert: AL-103 Y91F
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47093 Copy
Species: Homo sapiens
Genetic Insert: AL-103
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47090 Copy
Species: Homo sapiens
Genetic Insert: AL-103 Y32F
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47091 Copy
Species: Homo sapiens
Genetic Insert: AL-09 Y96F
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_47085 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
