Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
PCMV-intron myc Rab1a S25N Resource Report Resource Website 1+ mentions |
RRID:Addgene_46777 | Rab1a S25N mutant | Homo sapiens | Ampicillin | PMID:16959776 | cDNA was obtained from UMR cDNA Resource Center, www.cdna.org To make mutation, the following primers were used for PCR amplification: Rab1 S25N FWD (5′-AGCTCGGATCCACCATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGAATTGCCTTCTTCT-3′) BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′) | Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S25N (dominant negative) | 2026-07-25 12:47:37 | 2 |
|
pQHA-USP7 WT puroR Resource Report Resource Website 1+ mentions |
RRID:Addgene_46753 | USP7 | Homo sapiens | Ampicillin | PMID:20601937 | Sequence discrepancies between the full and QC sequences have no functional consequence. | Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:36 | 4 | |
|
pQHA-USP11 CS puroR Resource Report Resource Website 1+ mentions |
RRID:Addgene_46750 | USP11 | Homo sapiens | Ampicillin | PMID:20601937 | Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | C318S--catalytically inactive | 2026-07-25 12:47:36 | 3 | |
|
pQFlag-USP7 WT puroR Resource Report Resource Website 1+ mentions |
RRID:Addgene_46751 | USP7 | Homo sapiens | Ampicillin | PMID:20601937 | Sequence discrepancies between the full and QC sequences have no functional consequence. | Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:37 | 4 | |
|
pQHA-USP7 CS puroR Resource Report Resource Website 1+ mentions |
RRID:Addgene_46754 | USP7 | Homo sapiens | Ampicillin | PMID:20601937 | Sequence discrepancies between the full and QC sequences have no functional consequence. | Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | C223S--catalytically inactive | 2026-07-25 12:47:37 | 2 |
|
pQFlag-USP11 CS puroR Resource Report Resource Website 1+ mentions |
RRID:Addgene_46748 | USP11 | Homo sapiens | Ampicillin | PMID:20601937 | Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | C318S--catalytically inactive | 2026-07-25 12:47:37 | 1 | |
|
pBABE-Puro-KRas*G12V Resource Report Resource Website 10+ mentions |
RRID:Addgene_46746 | KRAS*G12V | Homo sapiens | Ampicillin | PMID:23246410 | Backbone Size:5169; Vector Backbone:pBABE-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | carries the oncogenic G12V mutation and cDNA is encoded by a chimeric mixture of HRAS and KRAS codons that encode KRas protein | 2026-07-25 12:47:36 | 14 | |
|
pMT mir-1-1 reporter hsa-mir-128-1 Resource Report Resource Website |
RRID:Addgene_46743 | hsa-mir-128-1 | Homo sapiens | Ampicillin | PMID:23415231 | Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:36 | 0 | ||
|
pCDH-puro-Bcl2 Resource Report Resource Website 10+ mentions |
RRID:Addgene_46971 | Bcl2 | Homo sapiens | Ampicillin | PMID:23403638 | Bcl-2 was cut from 3544 pMIG Bcl-2 (Addgene #8793) and subcloned into the EcoRI sites of pCDH-CMV-MCS-EF1-Puro. | Backbone Marker:System Biosciences; Vector Backbone:PCDH-CMV-MCS-EF1-PURO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:38 | 10 | |
|
pICE-EGFP-FLAG-Ku70siR-WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_46961 | human Ku70 | Homo sapiens | Ampicillin | PMID:23897892 | Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:38 | 1 | ||
|
pEGFP-C1-FLAG-Ku70 Resource Report Resource Website 10+ mentions |
RRID:Addgene_46957 | Ku70 | Homo sapiens | Kanamycin | PMID:23897892 | Backbone Size:4766; Vector Backbone:pEGFP-C1-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:47:38 | 13 | ||
|
p52sheLL Resource Report Resource Website 1+ mentions |
RRID:Addgene_46950 | HPV52L1+L2 | Homo sapiens | Ampicillin | PMID:18360909 | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:38 | 2 | ||
|
pIRES-Ap1g1-FKBP Resource Report Resource Website |
RRID:Addgene_46945 | Ap1g1-FKBP | Homo sapiens | Ampicillin | PMID:20159602 | Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:38 | 0 | ||
|
pIRES-Ap2a2-FKBP Resource Report Resource Website 1+ mentions |
RRID:Addgene_46944 | Ap2a2-FKBP | Homo sapiens | Ampicillin | PMID:20159602 | Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:38 | 1 | ||
|
pEYFP-Mitotrap Resource Report Resource Website 1+ mentions |
RRID:Addgene_46942 | Mitotrap | Homo sapiens | Kanamycin | PMID:20159602 | Backbone Marker:Clontech; Vector Backbone:pEYFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:47:38 | 4 | ||
|
pRK5-HA-SH3BP4 W92A Resource Report Resource Website |
RRID:Addgene_46893 | SH3BP4 W92A | Homo sapiens | Ampicillin | PMID:22575674 | Mutagenesis was performed using a site-directed mutagenesis kit (Stratagene) and the following primer: cacatctggcggtgaggcgtggtacgcacacaac | Backbone Marker:clonetch; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | W92A (mutated SH3 domain) | 2026-07-25 12:47:37 | 0 |
|
LZRSMS-GFP-hFJX1-Myc Resource Report Resource Website |
RRID:Addgene_46932 | FJX1 | Homo sapiens | Ampicillin | Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:38 | 0 | |||
|
pcDNA-zeo-hFJX1-myc Resource Report Resource Website |
RRID:Addgene_46930 | FJX1 | Homo sapiens | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5015; Vector Backbone:pcDNA3.1/Zeo(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:38 | 0 | |||
|
pCMV4a-hFJX1-Flag Resource Report Resource Website |
RRID:Addgene_46931 | FJX1 | Homo sapiens | Kanamycin | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag 4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:47:38 | 0 | |||
|
5HRE/GFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_46926 | 5X HRE of VEGF | Homo sapiens | Ampicillin | PMID:11774035 | The 35-bp human VEGF HRE sequence is: CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT The d2EGFP fragment was amplified from a Clontech (Palo Alto, CA) vector and encodes a destabilized red- shifted variant of wild-type GFP with an excitation maximum of 488 nm, an emission maximum of 507 nm, and a half-life of approximately 2 hours. | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pEF/myc/cyto; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | five copies of a 35-bp fragment from the hypoxia-responsive element (HRE) of the human VEGF gene and a human cytomegalovirus minimal promoter | 2026-07-25 12:47:38 | 24 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
