Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: hsa-mir-205
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_46679 Copy
Species: Homo sapiens
Genetic Insert: hsa-mir-138-2
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_46677 Copy
Species: Homo sapiens
Genetic Insert: hsa-mir-142
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_46678 Copy
Species: Homo sapiens
Genetic Insert: hsa-let-7a-1
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_46670 Copy
Species: Homo sapiens
Genetic Insert: miR-874 Decoy
Vector Backbone Description: Backbone Size:8233; Vector Backbone:AB.pCCLsin.PPT.U6.hPGK.GFP.wpre; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Depositor Website: http://www.mountsinai.org/profiles/brian-d-brown/ Please cite Mullokandov, Baccarini, Ruzo et al. Nature Methods 2013.
Proper citation: RRID:Addgene_46637 Copy
Species: Homo sapiens
Genetic Insert: miR-759 Decoy
Vector Backbone Description: Backbone Size:8233; Vector Backbone:AB.pCCLsin.PPT.U6.hPGK.GFP.wpre; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Depositor Website: http://www.mountsinai.org/profiles/brian-d-brown/ Please cite Mullokandov, Baccarini, Ruzo et al. Nature Methods 2013.
Proper citation: RRID:Addgene_46634 Copy
Species: Homo sapiens
Genetic Insert: miR-431 Decoy
Vector Backbone Description: Backbone Size:8233; Vector Backbone:AB.pCCLsin.PPT.U6.hPGK.GFP.wpre; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Depositor Website: http://www.mountsinai.org/profiles/brian-d-brown/ Please cite Mullokandov, Baccarini, Ruzo et al. Nature Methods 2013.
Proper citation: RRID:Addgene_46620 Copy
Species: Homo sapiens
Genetic Insert: miR-532-3p Decoy
Vector Backbone Description: Backbone Size:8233; Vector Backbone:AB.pCCLsin.PPT.U6.hPGK.GFP.wpre; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Depositor Website: http://www.mountsinai.org/profiles/brian-d-brown/ Please cite Mullokandov, Baccarini, Ruzo et al. Nature Methods 2013.
Proper citation: RRID:Addgene_46624 Copy
Species: Homo sapiens
Genetic Insert: attB and Hupki p53 wild type
Vector Backbone Description: Backbone Size:2977; Vector Backbone:pX1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_46851 Copy
Species: Homo sapiens
Genetic Insert: attB-Puro-2A and Hupki p53 wild type
Vector Backbone Description: Backbone Size:2977; Vector Backbone:pX1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_46852 Copy
Species: Homo sapiens
Genetic Insert: mir193b-wt
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_46734 Copy
Species: Homo sapiens
Genetic Insert: mir193b-3
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_46733 Copy
Species: Homo sapiens
Genetic Insert: MFGE8
Vector Backbone Description: Backbone Marker:Dr. Richard Iggo, University of St Andrews, Edinburgh, UK; Backbone Size:9195; Vector Backbone:psd44; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Originally from RSPD, Germany, plasmid IOH46424, in pDEST26 as backbone.
Proper citation: RRID:Addgene_46830 Copy
Species: Homo sapiens
Genetic Insert: PGK
Vector Backbone Description: Backbone Marker:Richard Mulligan; Backbone Size:4874; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_46793 Copy
Species: Homo sapiens
Genetic Insert: GNA13
Vector Backbone Description: Backbone Marker:Dr. Richard Iggo, University of St Andrews, Edinburgh, UK; Backbone Size:9195; Vector Backbone:psd44; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: cDNA to make this plasmid was obtained from www.cdna.org (ID GNA1300000).
Proper citation: RRID:Addgene_46829 Copy
Species: Homo sapiens
Genetic Insert: RAB11A S25N
Vector Backbone Description: Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: cDNA was obtained from UMR cDNA Resource Center, www.cdna.org
To make mutation, the following primers were used for PCR amplification:
Rab11 S25N FWD (5′-AGCTCGGATCCACCATGGGCACCCGCGACGACGAGT
ACGACTACCTCTTTAAAGTTGTCCTTATTGGAGATTCTGGTGTTGGAAAGAATAATCTCCTGTCT-3′)
BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′)
Proper citation: RRID:Addgene_46786 Copy
Species: Homo sapiens
Genetic Insert: RAB8A
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information.
Proper citation: RRID:Addgene_46783 Copy
Species: Homo sapiens
Genetic Insert: B-domain deleted FVIII H4 (R484H)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Polymorphisms described in:
Inhibitors of factor VIII in black patients with hemophilia.
Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE.
N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544.
PMID:1936966
Proper citation: RRID:Addgene_46774 Copy
Species: Homo sapiens
Genetic Insert: full length FVIII D1241E
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Polymorphisms described in:
Inhibitors of factor VIII in black patients with hemophilia.
Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE.
N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544.
PMID:1936966
Proper citation: RRID:Addgene_46773 Copy
Species: Homo sapiens
Genetic Insert: Rab1a
Vector Backbone Description: Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: cDNA was obtained from UMR cDNA Resource Center, www.cdna.org .
Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information.
Proper citation: RRID:Addgene_46776 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
