Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pcDNA3.2 mir-1-1 reporter hsa-mir-205 Resource Report Resource Website |
RRID:Addgene_46679 | hsa-mir-205 | Homo sapiens | Ampicillin | PMID:23415231 | Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:36 | 0 | ||
|
pcDNA3.2 mir-1-1 reporter hsa-mir-138-2 Resource Report Resource Website |
RRID:Addgene_46677 | hsa-mir-138-2 | Homo sapiens | Ampicillin | PMID:23415231 | Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:36 | 0 | ||
|
pcDNA3.2 mir-1-1 reporter hsa-mir-142 Resource Report Resource Website |
RRID:Addgene_46678 | hsa-mir-142 | Homo sapiens | Ampicillin | PMID:23415231 | Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:36 | 0 | ||
|
pcDNA3.2 mir-1-1 reporter hsa-let-7a-1 Resource Report Resource Website |
RRID:Addgene_46670 | hsa-let-7a-1 | Homo sapiens | Ampicillin | PMID:23415231 | Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:36 | 0 | ||
|
AB.pCCL.sin.cPPT.U6.miR-874-Decoy.hPGK.GFP.WPRE Resource Report Resource Website |
RRID:Addgene_46637 | miR-874 Decoy | Homo sapiens | Ampicillin | PMID:22751203 | Depositor Website: http://www.mountsinai.org/profiles/brian-d-brown/ Please cite Mullokandov, Baccarini, Ruzo et al. Nature Methods 2013. | Backbone Size:8233; Vector Backbone:AB.pCCLsin.PPT.U6.hPGK.GFP.wpre; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:36 | 0 | |
|
AB.pCCL.sin.cPPT.U6.miR-759-Decoy.hPGK.GFP.WPRE Resource Report Resource Website |
RRID:Addgene_46634 | miR-759 Decoy | Homo sapiens | Ampicillin | PMID:22751203 | Depositor Website: http://www.mountsinai.org/profiles/brian-d-brown/ Please cite Mullokandov, Baccarini, Ruzo et al. Nature Methods 2013. | Backbone Size:8233; Vector Backbone:AB.pCCLsin.PPT.U6.hPGK.GFP.wpre; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:36 | 0 | |
|
AB.pCCL.sin.cPPT.U6.miR-431-Decoy.hPGK.GFP.WPRE Resource Report Resource Website |
RRID:Addgene_46620 | miR-431 Decoy | Homo sapiens | Ampicillin | PMID:22751203 | Depositor Website: http://www.mountsinai.org/profiles/brian-d-brown/ Please cite Mullokandov, Baccarini, Ruzo et al. Nature Methods 2013. | Backbone Size:8233; Vector Backbone:AB.pCCLsin.PPT.U6.hPGK.GFP.wpre; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:35 | 0 | |
|
AB.pCCL.sin.cPPT.U6.miR-532-3p-Decoy.hPGK.GFP.WPRE Resource Report Resource Website |
RRID:Addgene_46624 | miR-532-3p Decoy | Homo sapiens | Ampicillin | PMID:22751203 | Depositor Website: http://www.mountsinai.org/profiles/brian-d-brown/ Please cite Mullokandov, Baccarini, Ruzo et al. Nature Methods 2013. | Backbone Size:8233; Vector Backbone:AB.pCCLsin.PPT.U6.hPGK.GFP.wpre; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:35 | 0 | |
|
pX41 Resource Report Resource Website |
RRID:Addgene_46851 | attB and Hupki p53 wild type | Homo sapiens | Ampicillin | PMID:21445009 | Backbone Size:2977; Vector Backbone:pX1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:37 | 0 | ||
|
pX61 Resource Report Resource Website |
RRID:Addgene_46852 | attB-Puro-2A and Hupki p53 wild type | Homo sapiens | Ampicillin | PMID:21445009 | Backbone Size:2977; Vector Backbone:pX1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:37 | 0 | ||
|
pcDNA3.2 mir-1-1 reporter mir193b-wt Resource Report Resource Website |
RRID:Addgene_46734 | mir193b-wt | Homo sapiens | Ampicillin | PMID:23415231 | Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:36 | 0 | ||
|
pcDNA3.2 mir-1-1 reporter mir193b-3 Resource Report Resource Website |
RRID:Addgene_46733 | mir193b-3 | Homo sapiens | Ampicillin | PMID:23415231 | Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | see sequence and publication | 2026-07-25 12:47:36 | 0 | |
|
psd44-Lactadherin46 Resource Report Resource Website |
RRID:Addgene_46830 | MFGE8 | Homo sapiens | Ampicillin | Originally from RSPD, Germany, plasmid IOH46424, in pDEST26 as backbone. | Backbone Marker:Dr. Richard Iggo, University of St Andrews, Edinburgh, UK; Backbone Size:9195; Vector Backbone:psd44; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:37 | 0 | ||
|
pHAGE PGK-GFP-IRES-LUC-W Resource Report Resource Website 10+ mentions |
RRID:Addgene_46793 | PGK | Homo sapiens | Ampicillin | PMID:20038801 | Backbone Marker:Richard Mulligan; Backbone Size:4874; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:37 | 24 | ||
|
psd44-G13WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_46829 | GNA13 | Homo sapiens | Ampicillin | cDNA to make this plasmid was obtained from www.cdna.org (ID GNA1300000). | Backbone Marker:Dr. Richard Iggo, University of St Andrews, Edinburgh, UK; Backbone Size:9195; Vector Backbone:psd44; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:37 | 2 | ||
|
PCMV-intron myc Rab11 S25N Resource Report Resource Website 1+ mentions |
RRID:Addgene_46786 | RAB11A S25N | Homo sapiens | Ampicillin | PMID:16959776 | cDNA was obtained from UMR cDNA Resource Center, www.cdna.org To make mutation, the following primers were used for PCR amplification: Rab11 S25N FWD (5′-AGCTCGGATCCACCATGGGCACCCGCGACGACGAGT ACGACTACCTCTTTAAAGTTGTCCTTATTGGAGATTCTGGTGTTGGAAAGAATAATCTCCTGTCT-3′) BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′) | Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S25N dominant negative | 2026-07-25 12:47:37 | 2 |
|
Rab8WT(Flag) in pcDNA3.1neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_46783 | RAB8A | Homo sapiens | Ampicillin | PMID:16959776 | Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information. | Backbone Marker:invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:37 | 2 | |
|
BDD FVIII H4 Resource Report Resource Website |
RRID:Addgene_46774 | B-domain deleted FVIII H4 (R484H) | Homo sapiens | Ampicillin | Polymorphisms described in: Inhibitors of factor VIII in black patients with hemophilia. Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE. N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544. PMID:1936966 | Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R484H | 2026-07-25 12:47:36 | 0 | |
|
FVIII H2 Resource Report Resource Website |
RRID:Addgene_46773 | full length FVIII D1241E | Homo sapiens | Ampicillin | Polymorphisms described in: Inhibitors of factor VIII in black patients with hemophilia. Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE. N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544. PMID:1936966 | Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | D1241E | 2026-07-25 12:47:36 | 0 | |
|
PCMV-intron myc Rab1aWT Resource Report Resource Website 1+ mentions |
RRID:Addgene_46776 | Rab1a | Homo sapiens | Ampicillin | PMID:16959776 | cDNA was obtained from UMR cDNA Resource Center, www.cdna.org . Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information. | Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:47:37 | 4 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
