Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Orai1
Vector Backbone Description: Backbone Size:0; Vector Backbone:EGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_19757 Copy
Species: Homo sapiens
Genetic Insert: cyclin-dependent kinase 8
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_19758 Copy
Species: Homo sapiens
Genetic Insert: small hairpin RNA against beta-catenin
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: 2279 refers to the shRNA
clone name from the RNAi Consortium at the Broad Institute and indicates the
location on the CTNNB1 mRNA that is targeted.
shRNA sequence for 2279 is:
CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTT
Proper citation: RRID:Addgene_19762 Copy
Species: Homo sapiens
Genetic Insert: c-myc
Vector Backbone Description: Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site.
Proper citation: RRID:Addgene_19763 Copy
Species: Homo sapiens
Genetic Insert: MKL1
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pCMV-3xFLAG-7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19852 Copy
Species: Homo sapiens
Genetic Insert: RHEBL1 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct.
Proper citation: RRID:Addgene_19858 Copy
Species: Homo sapiens
Genetic Insert: GSC 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_19859 Copy
Species: Homo sapiens
Genetic Insert: SIRT4 3' UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_19860 Copy
Species: Homo sapiens
Genetic Insert: IRF9 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct.
Proper citation: RRID:Addgene_19863 Copy
Species: Homo sapiens
Genetic Insert: hRpt6
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7700; Vector Backbone:pQCXIP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_19793 Copy
Species: Homo sapiens
Genetic Insert: NFRKB
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5400; Vector Backbone:BacPAK8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_19792 Copy
Species: Homo sapiens
Genetic Insert: CCDC95
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_19795 Copy
Species: Homo sapiens
Genetic Insert: TRF2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2820; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
References:
Comments: The missing codon is due to a reverse primer with a stop codon at 1474 of TRF2 gene: GAATTC TTA CTTCTGCTTTTTTGTTATATTGGTTGT. It generates a 50aa in frame deletion from c-terminal tail.
Proper citation: RRID:Addgene_19797 Copy
Species: Homo sapiens
Genetic Insert: Arp8
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_19796 Copy
Species: Homo sapiens
Genetic Insert: TRF2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5300; Vector Backbone:pIRES2-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_19798 Copy
Species: Homo sapiens
Genetic Insert: Fragment of p53-Binding Protein 1
Vector Backbone Description: Backbone Marker:Scott Lowe; Backbone Size:5600; Vector Backbone:pLPC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_19835 Copy
Species: Homo sapiens
Genetic Insert: MKL1
Vector Backbone Description: Backbone Marker:S Rees et al., BioTechniques 1996; Backbone Size:5257; Vector Backbone:pcin4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19838 Copy
Species: Homo sapiens
Genetic Insert: MKL1 D444-500
Vector Backbone Description: Backbone Marker:S Rees et al., BioTechniques 1996; Backbone Size:5257; Vector Backbone:pCin4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19839 Copy
Species: Homo sapiens
Genetic Insert: MKL1 D444-630
Vector Backbone Description: Backbone Marker:S Rees et al., BioTechniques 1996; Backbone Size:5257; Vector Backbone:pCin4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19840 Copy
Species: Homo sapiens
Genetic Insert: MKL1 T450A
Vector Backbone Description: Backbone Marker:S Rees et al., BioTechniques 1996; Backbone Size:5257; Vector Backbone:pCin4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19843 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
