Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: integrin alpha IIb
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6200; Vector Backbone:pEF1/V5-HisA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12230977
Proper citation: RRID:Addgene_27288 Copy
Species: Homo sapiens
Genetic Insert: low density lipoprotein receptor-related protein 6
Vector Backbone Description: Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:xenopus injection; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14731402
Comments: Dominant inhibitor of Wnt function, similar to LRPT-dC
Proper citation: RRID:Addgene_27283 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:p2xFlag CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20868367
Proper citation: RRID:Addgene_27419 Copy
Genetic Insert: miR156 target site
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCGTAG; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21123653
Comments: The miR156 sensor construct was created by cloning miR156 target sites into the control sensor plasmid (Addgene Plasmid # 27405).
miR156 target site in the 5' untranslated region (UTR) of a ubiquitously expressed nuclear-localized GFP.
Proper citation: RRID:Addgene_27412 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20048001
Proper citation: RRID:Addgene_27378 Copy
Species: Arabidopsis thaliana
Genetic Insert: SPL11 promoter
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCGTAG; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21123653
Comments: SPL11p::NLS-GFP was generated by PCR amplification of 2.2-kb genomic DNA. The resulting amplicon was then cloned into pCR8/GW-TOPO (Invitrogen) and recombined with pCGTAG.
The primers used to create this construct were 5'-AAATCTCGTCCAACT-3' and 5'-TCACGATATGGGTTG-3'.
Proper citation: RRID:Addgene_27411 Copy
Genetic Insert: sspBmyc
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:3725; Vector Backbone:pDE43-MCtNq1; Vector Types:Bacterial Expression, Gateway Cloning; Bacterial Resistance:Nourseothricin (clonNat)
Defining Citation: PMID:19174563
Proper citation: RRID:Addgene_27375 Copy
Genetic Insert: tetR(sB), clpXtb-K127R
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:6181; Vector Backbone:pDE43-MEH; Vector Types:Bacterial Expression, Gateway Cloning; Bacterial Resistance:Hygromycin
Defining Citation: PMID:19174563
Proper citation: RRID:Addgene_27374 Copy
Species: E. coli
Genetic Insert: dnaK, dnaJ
Vector Backbone Description: Backbone Size:7072; Vector Backbone:N/A; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:17565681
Comments: Please note that Addgene's sequencing results detect a single nucleotide insertion compared to depositor's sequence in the vector backbone. The plasmid expresses the expected functional protein.
Proper citation: RRID:Addgene_27392 Copy
Species: E. coli
Genetic Insert: lacIq
Vector Backbone Description: Backbone Size:4945; Vector Backbone:N/A; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:17565681
Comments: Protocol for preparing proteins with improved solubility by co-expressing with molecular chaperones in Escherichia coli.
de Marco A.
Nat Protoc. 2007;2(10):2632-9.
Proper citation: RRID:Addgene_27390 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4969; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20868367
Proper citation: RRID:Addgene_27425 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4969; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20868367
Proper citation: RRID:Addgene_27424 Copy
Vector Backbone Description: Backbone Size:6127; Vector Backbone:pUC19; Vector Types:Burkholderia allelic exchange suicide vector pMo130; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19010402
Comments: Ref: EU862243
MCS-1: ApaI, NheI, BglII, SmaI, HindIII
MCS-2 NotI, PstI, BamHI, XbaI, SphI
Please note that Addgene's sequencing results identified a single nucleotide mismatch at bp# 5006, a 5 nucleotide deletion at bp# 5981-5985 and a region from bp#1010-1060 with several mismatches/deletions, when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing scientist, these differences do not affect the function of the plasmid.
Proper citation: RRID:Addgene_27388 Copy
Species: E. coli
Genetic Insert: pMo168
Vector Backbone Description: Backbone Size:7108; Vector Backbone:pBBR1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19010402
Comments: Please note that Addgene's sequencing results identified a single nucleotide mismatch at bp# 5987 and a 5 nucleotide deletion at bp# 6962-6966, when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing scientist, these differences do not affect the function of the plasmid.
Proper citation: RRID:Addgene_27389 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20868367
Proper citation: RRID:Addgene_27422 Copy
Species: Homo sapiens
Genetic Insert: unligated form of ligase ribozyme
Vector Backbone Description: Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19965478
Comments: Improved class I ligase modified at the end of P5 with four additional base pairs terminating in the U1A-
binding loop. DNA representing the unligated form of this ribozyme was
subcloned into pUC19 under a T7 transcription promoter,
followed by a genomic hepatitis delta virus (HDV) self-cleaving ribozyme and an
EarI restriction site, yielding the plasmid p307HU. The HDV sequence cleaves itself from the ribozyme 3´ terminus, thereby producing a homogenous ribozyme 3´ end. The relevant sequence of the insert was
GCGTAATACGACTCACTATAGGAACACTATACTACTGGATAATCAAAGACAAATCTGCC
CGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCTCCGGT
GGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCCTCGCT
GGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGGGACCC
AC
See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was
digested with EarI nuclease.
Proper citation: RRID:Addgene_27386 Copy
Species: Arabidopsis thaliana
Genetic Insert: SPL11 mutant
Vector Backbone Description: Backbone Size:0; Vector Backbone:pBIB-KAN-GW; Vector Types:used to create transgenic lines; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21123653
Comments: Created by cloning 5.5-kb (including 2.7 kb upstream of
CDS, CDS, and 1.3 kb downstream from CDS) genomic fragment in pENTR/D-TOPO (Invitrogen). The Quick-
Change Lightning Site-Directed Mutagenesis kit (Stratagene) was used on the resulting plasmids to disrupt miR156-binding sites (primers 5'-AATCTCAAGATATCCACCGTGCACTGTCATTGCTCTCAACCTCTTCGGATCCCCTGG-3' and 5'-CCAGGGGATCCGAAGAGGTTGAGAGCAATGACAGTGCACGGTGGATATCTTGAGATT-3').
This plasmid was recombined with pBIB-KAN-GW using LR clonase (Invitrogen).
Proper citation: RRID:Addgene_27387 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20868367
Proper citation: RRID:Addgene_27420 Copy
Species: Homo sapiens
Genetic Insert: post- ligation product of ligase ribozyme
Vector Backbone Description: Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19965478
Comments: pH307HP is used to transcribe RNA representing the post-
ligation product of the ribozyme. To ensure a homogenous 5´ terminus with the 5´- hydroxyl resembling that of the synthetic substrate, the transcript began with a hammerhead (HH) self-cleaving ribozyme, which excises itself from the ribozyme. The relevant sequence of the insert is
GCGTAATACGACTCACTATAGGGAGATTCCTACTGGACTGATGAGTCCGTGAGGACGAA
ACGGTACCCGGTACCGTCTCCAGTAGGAACACTATACTACTGGATAATCAAAGACAAAT
CTGCCCGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCT
CCGGTGGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCC
TCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGG
GACCCAC
See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was
digested with EarI nuclease.
Proper citation: RRID:Addgene_27385 Copy
Species: Homo sapiens
Genetic Insert: Gja1
Vector Backbone Description: Backbone Size:9387; Vector Backbone:plenti6.3/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20038810
Proper citation: RRID:Addgene_27383 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
