Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: TTR:Cre
Vector Backbone Description: Vector Backbone:pTTR1ExV3; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments: The Ttr::Cre construct was generated by inserting a 1.1 kb
nlsCre (Lewandoski et al., 1997) fragment into the second exon of pTTR1ExV3 (Costa et al.,
1990).
Proper citation: RRID:Addgene_32606 Copy
Species: Mus musculus
Genetic Insert: Talin-1 Head aa 1-433
Vector Backbone Description: Backbone Marker:BD Clontech; Backbone Size:4749; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Please note that the most appropriate reference sequence for the Talin1 insert in this plasmid is GenBank accession number CAA39588.1
Proper citation: RRID:Addgene_32856 Copy
Species: Mus musculus
Genetic Insert: solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1/Hygro(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_32706 Copy
Species: Mus musculus
Genetic Insert: Smad3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6600; Vector Backbone:pSIREN-DNR-DsRed; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: Primers used to generate shRNA:
Upper: 5’–
GATCCACCTGAGTGAAGATGGAGATTCAAGAGATCTCCATCTTCACTCAGGTTTTTTTACGCGTG–3’
Lower: 3’– AATTCACGCGTAAAAAAACCTGAGTGAAGATGGAGATCTCTTGAATCTCCATCTTCACTCAGGTG-5'
Proper citation: RRID:Addgene_32806 Copy
Species: Mus musculus
Genetic Insert: Mcl-1
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:6307; Vector Backbone:p3XFlag-CMV10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_32978 Copy
Species: Mus musculus
Genetic Insert: LIM homeobox transcription factor 1 alpha
Vector Backbone Description: Backbone Marker:Malin Parmar; Backbone Size:7041; Vector Backbone:pCCL-cppt-PGK-WPRE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33013 Copy
Species: Mus musculus
Genetic Insert: Forkhead box A2
Vector Backbone Description: Backbone Marker:Malin Parmar; Backbone Size:7041; Vector Backbone:pCCL-cppt-PGK-WPRE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Please note that Addgene's sequencing data shows a H10L mutation is present compared to the depositor's sequence. This mutation is a known variant of mouse Foxa2 (GenBank: CAA52891.1).
Proper citation: RRID:Addgene_33014 Copy
Species: Mus musculus
Genetic Insert: MEF2D
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:p3XFlag-CMV-7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_32964 Copy
Species: Mus musculus
Genetic Insert: forkhead box A1
Vector Backbone Description: Vector Backbone:pGCDNsam; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33007 Copy
Species: Mus musculus
Genetic Insert: forkhead box A2
Vector Backbone Description: Vector Backbone:pGCDNsam; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33004 Copy
Species: Mus musculus
Genetic Insert: forkhead box A3
Vector Backbone Description: Vector Backbone:pGCDNsam; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33005 Copy
Species: Mus musculus
Genetic Insert: forkhead box A3
Vector Backbone Description: Vector Backbone:pGCDNsam; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33009 Copy
Species: Mus musculus
Genetic Insert: Hb9
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_32930 Copy
Species: Mus musculus
Genetic Insert: Sox1
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_32931 Copy
Species: Mus musculus
Genetic Insert: Pax6 (isoform 2, transcript variant 5)
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_32932 Copy
Species: Mus musculus
Genetic Insert: GATA4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pEntr3c; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_32937 Copy
Species: Mus musculus
Genetic Insert: Mcl-1
Vector Backbone Description: Backbone Size:6295; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_32981 Copy
Species: Mus musculus
Genetic Insert: Mcl-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2746; Vector Backbone:pGEM-4Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_32984 Copy
Species: Mus musculus
Genetic Insert: Mcl-1
Vector Backbone Description: Backbone Size:6295; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_32983 Copy
Species: Mus musculus
Genetic Insert: CBP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_32908 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
