Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,374 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
phMYT1L-N106
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_60861 MYT1L Homo sapiens Ampicillin PMID:25374357 Backbone Marker:Homemade; Backbone Size:8465; Vector Backbone:N106; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:49:29 1
CIP2Aprom1802bp-pGL4.10Luc
 
Resource Report
Resource Website 		RRID:Addgene_60868 1802 bp promoter fragment of Cancerous Inhibitor of PP2A Homo sapiens Ampicillin PMID:21445343 Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function. Backbone Marker:Promega; Backbone Size:4242; Vector Backbone:pGL4.10(luc2); Vector Types:Luciferase, Promoterless; Bacterial Resistance:Ampicillin 2026-07-25 12:49:29 0
CIP2Aprom204bp-pGL4.10Luc
 
Resource Report
Resource Website 		RRID:Addgene_60874 204 bp promoter fragment of Cancerous Inhibitor of PP2A Homo sapiens Ampicillin PMID:21445343 Then various length luciferase promoter constructs were created using the Deletion Kit for Kilo-Sequencing (Takara Bio Inc., Japan) as per the manufacturer’s instructions. Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function. Backbone Marker:Promega; Backbone Size:4242; Vector Backbone:pGL4.10(luc2); Vector Types:Luciferase, Promoterless; Bacterial Resistance:Ampicillin 2026-07-25 12:49:29 0
CIP2Aprom285bp-pGL4.10Luc
 
Resource Report
Resource Website 		RRID:Addgene_60873 285 bp promoter fragment of Cancerous Inhibitor of PP2A2 Homo sapiens Ampicillin PMID:21445343 Then various length luciferase promoter constructs were created using the Deletion Kit for Kilo-Sequencing (Takara Bio Inc., Japan) as per the manufacturer’s instructions. Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function. Backbone Marker:Promega; Backbone Size:4242; Vector Backbone:pGL4.10(luc2); Vector Types:Luciferase, Promoterless; Bacterial Resistance:Ampicillin 2026-07-25 12:49:29 0
GST-PBD H538A/K540M
 
Resource Report
Resource Website 		RRID:Addgene_60879 Polo-like kinase 1 Homo sapiens Ampicillin PMID:23455152 Backbone Size:4969; Vector Backbone:pGEX-4T-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin H538A/K540M 2026-07-25 12:49:29 0
pSIN4-EF1a-LMO2-IRES-Puro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61064 LMO2 Homo sapiens Ampicillin PMID:25019369 Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:49:30 1
pSIN4-EF1a-GATA2-IRES-Puro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61063 GATA2 Homo sapiens Ampicillin PMID:25019369 Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:49:30 2
pSIN4-EF1a-ETV2-IRES-Puro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61061 ETV2 Homo sapiens Ampicillin PMID:25019369 Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:49:30 5
pSIN4-EF1a-TAL1-IRES-Puro
 
Resource Report
Resource Website 		RRID:Addgene_61065 TAL1 Homo sapiens Ampicillin PMID:25019369 Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:49:30 0
pCDNA3-V5-PTPN14-PPxY
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61006 PTPN14 PPxY mutation Homo sapiens Ampicillin PMID:25023289 Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin PPxY mutation 2026-07-25 12:49:30 1
pCDNA3-V5-PTPN14-del-C
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61005 PTPN14 delete C Homo sapiens Ampicillin PMID:25023289 Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 934-1187 2026-07-25 12:49:30 2
pCDNA3-V5-PTPN14-del-N
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61004 PTPN14 delete N Homo sapiens Ampicillin PMID:25023289 Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 17-310 2026-07-25 12:49:30 2
pCDNA3-V5-PTPN14-wild type
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61003 PTPN14 Homo sapiens Ampicillin PMID:25023289 Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:49:30 2
UbcH5A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61081 UbcH5A Homo sapiens Ampicillin PMID:23955022 Backbone Marker:Novagen, modified; Backbone Size:6000; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:49:30 2
gRNA-hIRF-1 #12/pSIR
 
Resource Report
Resource Website 		RRID:Addgene_61080 gRNA_hIRF1 promoter #12 Homo sapiens Ampicillin PMID:25051498 gRNA target sequence: CCGGGGGCGCTGGGCTGTCCCGG Backbone Marker:Clontech; Backbone Size:8083; Vector Backbone:pSIR; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin 2026-07-25 12:49:30 0
pUC-H1-gRNA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61089 H1 promoter; gRNA sequences Homo sapiens Ampicillin PMID:25209046 As Ampicillin gene and H1 promoter contain BsaI sites, we mutated the sequence of Amp gene (G1601C, not change amino acid), and mutated H1 promoter from GAGACC to GAGGACC to eliminate the BsaI internal site. Backbone Size:2636; Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, /Cas9 gRNA cloning vector; Bacterial Resistance:Ampicillin 2026-07-25 12:49:31 2
SENP2M497A
 
Resource Report
Resource Website 		RRID:Addgene_61088 SENP2M497A catalytic domain Homo sapiens Kanamycin PMID:23955022 Backbone Marker:Novagen; Backbone Size:7328; Vector Backbone:PET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin M497A; Catalytic domain is residues 364-589 2026-07-25 12:49:31 0
pBabe-Hygro-FLAG-hDIXDC1 WT
 
Resource Report
Resource Website 		RRID:Addgene_61213 human DIXDC1 Homo sapiens Ampicillin PMID:25042806 Backbone Size:5200; Vector Backbone:pBabe-Hygro-DEST; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-07-25 12:49:31 0
pLenti-CMV/TO-Puro-FLAG-hDIXDC1 WT
 
Resource Report
Resource Website 		RRID:Addgene_61218 human DIXDC1 Homo sapiens Ampicillin PMID:25042806 Backbone Size:8410; Vector Backbone:pLenti-CMV/TO-PURO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:49:31 0
pQCXIB-FLAG-hDIXDC1-L-S592A
 
Resource Report
Resource Website 		RRID:Addgene_61225 human DIXDC1 Homo sapiens Ampicillin PMID:25042806 Backbone Marker:Addgene #17400; Backbone Size:8614; Vector Backbone:pQCXIB; Vector Types:Retroviral; Bacterial Resistance:Ampicillin Changed Serine 592 to Alanine 2026-07-25 12:49:31 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch