Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: MYT1L
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:8465; Vector Backbone:N106; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_60861 Copy
Species: Homo sapiens
Genetic Insert: 1802 bp promoter fragment of Cancerous Inhibitor of PP2A
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4242; Vector Backbone:pGL4.10(luc2); Vector Types:Luciferase, Promoterless; Bacterial Resistance:Ampicillin
References:
Comments: Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
Proper citation: RRID:Addgene_60868 Copy
Species: Homo sapiens
Genetic Insert: 204 bp promoter fragment of Cancerous Inhibitor of PP2A
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4242; Vector Backbone:pGL4.10(luc2); Vector Types:Luciferase, Promoterless; Bacterial Resistance:Ampicillin
References:
Comments: Then various length luciferase promoter constructs were created using the Deletion Kit for Kilo-Sequencing (Takara Bio Inc., Japan) as per the manufacturer’s instructions. Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
Proper citation: RRID:Addgene_60874 Copy
Species: Homo sapiens
Genetic Insert: 285 bp promoter fragment of Cancerous Inhibitor of PP2A2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4242; Vector Backbone:pGL4.10(luc2); Vector Types:Luciferase, Promoterless; Bacterial Resistance:Ampicillin
References:
Comments: Then various length luciferase promoter constructs were created using the Deletion Kit for Kilo-Sequencing (Takara Bio Inc., Japan) as per the manufacturer’s instructions. Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
Proper citation: RRID:Addgene_60873 Copy
Species: Homo sapiens
Genetic Insert: Polo-like kinase 1
Vector Backbone Description: Backbone Size:4969; Vector Backbone:pGEX-4T-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_60879 Copy
Species: Homo sapiens
Genetic Insert: LMO2
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_61064 Copy
Species: Homo sapiens
Genetic Insert: GATA2
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_61063 Copy
Species: Homo sapiens
Genetic Insert: ETV2
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_61061 Copy
Species: Homo sapiens
Genetic Insert: TAL1
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_61065 Copy
Species: Homo sapiens
Genetic Insert: PTPN14 PPxY mutation
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_61006 Copy
Species: Homo sapiens
Genetic Insert: PTPN14 delete C
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_61005 Copy
Species: Homo sapiens
Genetic Insert: PTPN14 delete N
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_61004 Copy
Species: Homo sapiens
Genetic Insert: PTPN14
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_61003 Copy
Species: Homo sapiens
Genetic Insert: UbcH5A
Vector Backbone Description: Backbone Marker:Novagen, modified; Backbone Size:6000; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_61081 Copy
Species: Homo sapiens
Genetic Insert: gRNA_hIRF1 promoter #12
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:8083; Vector Backbone:pSIR; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: gRNA target sequence: CCGGGGGCGCTGGGCTGTCCCGG
Proper citation: RRID:Addgene_61080 Copy
Species: Homo sapiens
Genetic Insert: H1 promoter; gRNA sequences
Vector Backbone Description: Backbone Size:2636; Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, /Cas9 gRNA cloning vector; Bacterial Resistance:Ampicillin
References:
Comments: As Ampicillin gene and H1 promoter contain BsaI sites, we mutated the sequence of Amp gene (G1601C, not change amino acid), and mutated H1 promoter from GAGACC to GAGGACC to eliminate the BsaI internal site.
Proper citation: RRID:Addgene_61089 Copy
Species: Homo sapiens
Genetic Insert: SENP2M497A catalytic domain
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7328; Vector Backbone:PET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_61088 Copy
Species: Homo sapiens
Genetic Insert: human DIXDC1
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBabe-Hygro-DEST; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_61213 Copy
Species: Homo sapiens
Genetic Insert: human DIXDC1
Vector Backbone Description: Backbone Size:8410; Vector Backbone:pLenti-CMV/TO-PURO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_61218 Copy
Species: Homo sapiens
Genetic Insert: human DIXDC1
Vector Backbone Description: Backbone Marker:Addgene #17400; Backbone Size:8614; Vector Backbone:pQCXIB; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_61225 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
