Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pcDNA3.1 Flag YFP hNKCC1 C723S C724V W732C (NT546) Resource Report Resource Website |
RRID:Addgene_50908 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C723S C724V W732C in hNKCC1 in NT17 | 2026-07-25 12:48:08 | 0 | |
|
pcDNA3.1 Flag YFP hNKCC1 C723S C724V V726C (NT539) Resource Report Resource Website |
RRID:Addgene_50904 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C723S C724V V726C in hNKCC1 in NT17 | 2026-07-25 12:48:08 | 0 | |
|
pcDNA3.1 Flag YFP hNKCC1 E670C (NT473) Resource Report Resource Website |
RRID:Addgene_50871 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | E670C in hNKCC1 in NT17 | 2026-07-25 12:48:08 | 0 | |
|
pcDNA3.1 Flag YFP hNKCC1 C723S C724V A735C (NT549) Resource Report Resource Website |
RRID:Addgene_50910 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24451383 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C723S C724V A735C in hNKCC1 in NT17 | 2026-07-25 12:48:09 | 0 |
|
pcDNA3.1 Flag YFP hNKCC1 A675C (NT441) Resource Report Resource Website |
RRID:Addgene_50876 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24451383 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | A675C in hNKCC1 in NT17 | 2026-07-25 12:48:08 | 0 |
|
pcDNA3.1 Flag YFP hNKCC1 I677C (NT467) Resource Report Resource Website |
RRID:Addgene_50878 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24451383 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | I677C in hNKCC1 in NT17 | 2026-07-25 12:48:08 | 0 |
|
pcDNA3.1 Flag YFP hNKCC1 V729S (NT553) Resource Report Resource Website |
RRID:Addgene_50911 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | V729S in hNKCC1 in NT17 | 2026-07-25 12:48:09 | 0 | |
|
pcDNA3.1 Flag YFP hNKCC1 N672C (NT474) Resource Report Resource Website |
RRID:Addgene_50873 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24451383 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N672C in hNKCC1 in NT17 | 2026-07-25 12:48:08 | 0 |
|
pcDNA3.1 Flag YFP hNKCC1 L671C (NT440) Resource Report Resource Website |
RRID:Addgene_50872 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | L671C in hNKCC1 in NT17 | 2026-07-25 12:48:08 | 0 | |
|
pcDNA3.1 Flag YFP hNKCC1 I674C (NT475) Resource Report Resource Website |
RRID:Addgene_50875 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24451383 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | I674C in hNKCC1 in NT17 | 2026-07-25 12:48:08 | 0 |
|
pcDNA3.1 Flag YFP hNKCC1 P676C I730C N-terminal deletion (NT96) Resource Report Resource Website |
RRID:Addgene_50914 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24451383 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | P676C I730C N-term deletion of aa13-222 in hNKCC1 in NT17 | 2026-07-25 12:48:09 | 0 |
|
pcDNA3.1 Flag YFP hNKCC1 S679C (NT447) Resource Report Resource Website |
RRID:Addgene_50880 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24451383 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S679C in hNKCC1 in NT17 | 2026-07-25 12:48:08 | 0 |
|
pcDNA3.1 Flag YFP hNKCC1 F728C (NT502) Resource Report Resource Website |
RRID:Addgene_50882 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | F728C in hNKCC1 in NT17 | 2026-07-25 12:48:08 | 0 | |
|
pcDNA3.1 Flag YFP hNKCC1 N680C (NT468) Resource Report Resource Website |
RRID:Addgene_50881 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24451383 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N680C in hNKCC1 in NT17 | 2026-07-25 12:48:08 | 0 |
|
pcDNA3.1 Flag YFP hNKCC1 A734C (NT508) Resource Report Resource Website |
RRID:Addgene_50888 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | A734C in hNKCC1 in NT17 | 2026-07-25 12:48:08 | 0 | |
|
pLKO.1-puro U6 sgRNA Oct4A -12 Resource Report Resource Website |
RRID:Addgene_50921 | Oct4A -12 sgRNA | Homo sapiens | Ampicillin | PMID:24346702 | gRNA target sequence GTGGGACTGGGGAGGGAGAG | Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:48:09 | 0 | |
|
pLKO.1-puro U6 sgRNA SOX17 -91 Resource Report Resource Website |
RRID:Addgene_50923 | Sox17 -91 sgRNA | Homo sapiens | Ampicillin | PMID:24346702 | gRNA target sequence GGGCGTGGGCCTAACGACGC | Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:48:09 | 0 | |
|
pLKO.1-puro U6 sgRNA Oct4A -158 Resource Report Resource Website |
RRID:Addgene_50922 | Oct4A -158 sgRNA | Homo sapiens | Ampicillin | PMID:24346702 | gRNA target sequence GGGGCGCCAGTTGTGTCTCC | Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:48:09 | 0 | |
|
pcDNA3.1 Flag YFP hNKCC1 I730C (NT504) Resource Report Resource Website |
RRID:Addgene_50884 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24451383 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | I730C in hNKCC1 in NT17 | 2026-07-25 12:48:08 | 0 |
|
pLKO.1-puro U6 sgRNA SOX17 -177 Resource Report Resource Website |
RRID:Addgene_50925 | Sox17 -177 sgRNA | Homo sapiens | Ampicillin | PMID:24346702 | gRNA target sequence GCTCCGGCTAGTTTTCCCGG | Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:48:09 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.