Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,915 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
AAV-KrasG13S/sgKras/Cre
 
Resource Report
Resource Website 		RRID:Addgene_99859 Kras Mus musculus Ampicillin PMID:29233960 https://benchling.com/s/seq-2y1YV8OIA9ubvJVqQRkH Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), G13S mutation (GGC>AGC), Barcode = (AGGCAAGAGCGCCTTGACGATA>AGGGAAATCTGCCCTGACCATA), BsiWI site (CGTGCG>CGTACG) 2026-07-25 12:54:20 0
iMb-Notch-Mosaic (IR99.40)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_99749 MbYFP, MbTomato, MbKate2, DN-Rbpj and NICD-PEST Mus musculus Ampicillin PMID:28802047 Vector Backbone:pBlueScript KS; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin 2026-07-25 12:54:20 2
pOC2 Tubb3 no donor
 
Resource Report
Resource Website 		RRID:Addgene_183431 gRNA Mus musculus Ampicillin PMID:35851300 Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-07-25 12:54:23 0
pOC2 Dlg4-Halo-FKBP KI
 
Resource Report
Resource Website 		RRID:Addgene_183435 gRNA and Halo-FKBP donor Mus musculus Ampicillin PMID:35851300 Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-07-25 12:54:23 0
pLeGO.sgGata1.4.RUNX1A.iG2
 
Resource Report
Resource Website 		RRID:Addgene_181976 GATA1 gRNA: CCTAGACCAGGAAAATCCAT Mus musculus Ampicillin PMID:36493345 Vector Backbone:pLeGO.iG2 ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:54:22 0
pQCXIP-EGFP-CDMPR
 
Resource Report
Resource Website 		RRID:Addgene_182642 CDMPR Mus musculus Ampicillin PMID:35314489 Backbone Marker:Clontech/Takara Bio; Backbone Size:7181; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-07-25 12:54:22 0
pOC3 smFP-HA-Cacna1e KI
 
Resource Report
Resource Website 		RRID:Addgene_183436 gRNA and smFP HA donor Mus musculus Ampicillin PMID:35851300 Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. Vector Backbone:pOC3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-07-25 12:54:23 0
pORANGE Tubb3-2xGFP KI
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_183443 gRNA and 2xGFP donor Mus musculus Ampicillin PMID:35851300 Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. Vector Backbone:pORANGE; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-07-25 12:54:23 1
pOC5 Tubb3-GFP KI
 
Resource Report
Resource Website 		RRID:Addgene_183440 gRNA and GFP donor Mus musculus Ampicillin PMID:35851300 Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. Vector Backbone:pOC5; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-07-25 12:54:23 0
pAD-CMV-STAT5A-CMV-GFP
 
Resource Report
Resource Website 		RRID:Addgene_83251 Stat5a Mus musculus Ampicillin PMID:27131881 Backbone Marker:Invitrogen; Vector Backbone:pAD/CMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin 2026-07-25 12:54:23 0
Stargazin-mCherry-FRB
 
Resource Report
Resource Website 		RRID:Addgene_172443 Cacng2 Mus musculus Kanamycin PMID:35486148 Read the preprint on bioRxiv: https://www.biorxiv.org/content/10.1101/2021.04.23.441091v3. Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-07-25 12:54:23 0
px335 Slc1a3 nickase 2
 
Resource Report
Resource Website 		RRID:Addgene_129411 sgRNA targeting Slc1a3 Mus musculus Ampicillin PMID:33686166 Vector Backbone:pX335; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin 2026-07-25 12:54:24 0
pET28_mouse-Caspase-1_enzymatic-domain
 
Resource Report
Resource Website 		RRID:Addgene_183385 Caspase-1 (AA130-404) Mus musculus Kanamycin PMID:34734155 Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-07-25 12:54:26 0
pMSCV-IRES-GFP-Hybrid-caspase_mouse-caspase-11-CARD+canine-Caspase-1/4-catalytic domain
 
Resource Report
Resource Website 		RRID:Addgene_183398 CARD domain of mouse caspase-11 fused to catalytic domain of canine caspase-1/4 Mus musculus Ampicillin PMID:34734155 Backbone Size:6400; Vector Backbone:pMSCV-IRES-EGFP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-07-25 12:54:26 0
pMSCV-IRES-GFP-Hybrid-caspase_canine-CARDs+mouse-Caspase-11-catalytic domain
 
Resource Report
Resource Website 		RRID:Addgene_183396 CARD domains of canine caspase-1/4 fused to catalytic domain of mouse caspase-11 Mus musculus Ampicillin PMID:34734155 Backbone Size:6400; Vector Backbone:pMSCV-IRES-EGFP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-07-25 12:54:26 0
Lenti-sgBap1#1/Cre
 
Resource Report
Resource Website 		RRID:Addgene_173581 gRNA targeting Bap1 Mus musculus Ampicillin PMID:33608386 Vector Backbone:pLL3.3; Vector Types:Lentiviral, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 2026-07-25 12:54:27 0
Lenti-sgAtf7ip#2/Cre
 
Resource Report
Resource Website 		RRID:Addgene_173578 gRNA targeting Atf7ip Mus musculus Ampicillin PMID:33608386 Vector Backbone:pLL3.3; Vector Types:Lentiviral, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 2026-07-25 12:54:27 0
pET28_mouse-pro-IL18
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_183389 pro-IL18 Mus musculus Kanamycin PMID:34734155 Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-07-25 12:54:26 1
tdTomato--β-actin CDS2
 
Resource Report
Resource Website 		RRID:Addgene_183714 tdTomato with fragment (nucleotides 398-818) of mouse Actb coding dsequence Mus musculus Ampicillin PMID:37249209 Please visit https://www.biorxiv.org/content/10.1101/2021.11.28.470233v2 for bioRxiv preprint. Backbone Size:7838; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:54:27 0
tdTomato-β-actin3'UTR1
 
Resource Report
Resource Website 		RRID:Addgene_183716 tdTomato with fragment (nucleotides 1-440) of mouse Actb 3'UTR Mus musculus Ampicillin PMID:37249209 Please visit https://www.biorxiv.org/content/10.1101/2021.11.28.470233v2 for bioRxiv preprint. Backbone Size:7838; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:54:27 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch