Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: https://benchling.com/s/seq-2y1YV8OIA9ubvJVqQRkH
Proper citation: RRID:Addgene_99859 Copy
Species: Mus musculus
Genetic Insert: MbYFP, MbTomato, MbKate2, DN-Rbpj and NICD-PEST
Vector Backbone Description: Vector Backbone:pBlueScript KS; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_99749 Copy
Species: Mus musculus
Genetic Insert: gRNA
Vector Backbone Description: Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_183431 Copy
Species: Mus musculus
Genetic Insert: gRNA and Halo-FKBP donor
Vector Backbone Description: Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_183435 Copy
Species: Mus musculus
Genetic Insert: GATA1 gRNA: CCTAGACCAGGAAAATCCAT
Vector Backbone Description: Vector Backbone:pLeGO.iG2 ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_181976 Copy
Species: Mus musculus
Genetic Insert: CDMPR
Vector Backbone Description: Backbone Marker:Clontech/Takara Bio; Backbone Size:7181; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_182642 Copy
Species: Mus musculus
Genetic Insert: gRNA and smFP HA donor
Vector Backbone Description: Vector Backbone:pOC3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_183436 Copy
Species: Mus musculus
Genetic Insert: gRNA and 2xGFP donor
Vector Backbone Description: Vector Backbone:pORANGE; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_183443 Copy
Species: Mus musculus
Genetic Insert: gRNA and GFP donor
Vector Backbone Description: Vector Backbone:pOC5; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_183440 Copy
Species: Mus musculus
Genetic Insert: Stat5a
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pAD/CMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_83251 Copy
Species: Mus musculus
Genetic Insert: Cacng2
Vector Backbone Description: Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Read the preprint on bioRxiv: https://www.biorxiv.org/content/10.1101/2021.04.23.441091v3.
Proper citation: RRID:Addgene_172443 Copy
Species: Mus musculus
Genetic Insert: sgRNA targeting Slc1a3
Vector Backbone Description: Vector Backbone:pX335; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_129411 Copy
Species: Mus musculus
Genetic Insert: Caspase-1 (AA130-404)
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_183385 Copy
Species: Mus musculus
Genetic Insert: CARD domain of mouse caspase-11 fused to catalytic domain of canine caspase-1/4
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pMSCV-IRES-EGFP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_183398 Copy
Species: Mus musculus
Genetic Insert: CARD domains of canine caspase-1/4 fused to catalytic domain of mouse caspase-11
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pMSCV-IRES-EGFP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_183396 Copy
Species: Mus musculus
Genetic Insert: gRNA targeting Bap1
Vector Backbone Description: Vector Backbone:pLL3.3; Vector Types:Lentiviral, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_173581 Copy
Species: Mus musculus
Genetic Insert: gRNA targeting Atf7ip
Vector Backbone Description: Vector Backbone:pLL3.3; Vector Types:Lentiviral, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_173578 Copy
Species: Mus musculus
Genetic Insert: pro-IL18
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_183389 Copy
Species: Mus musculus
Genetic Insert: tdTomato with fragment (nucleotides 398-818) of mouse Actb coding dsequence
Vector Backbone Description: Backbone Size:7838; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.11.28.470233v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_183714 Copy
Species: Mus musculus
Genetic Insert: tdTomato with fragment (nucleotides 1-440) of mouse Actb 3'UTR
Vector Backbone Description: Backbone Size:7838; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.11.28.470233v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_183716 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.