Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,915 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl E
 
Resource Report
Resource Website 		RRID:Addgene_89374 Irf2bpl Mus musculus Chloramphenicol and Ampicillin PMID:27965291 Backbone Marker:Nadav Ahituv lab; Vector Backbone:E1b-GFP-Tol2-Gateway; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-07-25 12:53:33 0
E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl G
 
Resource Report
Resource Website 		RRID:Addgene_89376 Irf2bpl Mus musculus Chloramphenicol and Ampicillin PMID:27965291 Backbone Marker:Nadav Ahituv lab; Vector Backbone:E1b-GFP-Tol2-Gateway; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-07-25 12:53:33 0
E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl F
 
Resource Report
Resource Website 		RRID:Addgene_89375 Irf2bpl Mus musculus Chloramphenicol and Ampicillin PMID:27965291 Backbone Marker:Nadav Ahituv lab; Vector Backbone:E1b-GFP-Tol2-Gateway; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-07-25 12:53:33 0
E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl J
 
Resource Report
Resource Website 		RRID:Addgene_89379 Irf2bpl Mus musculus Chloramphenicol and Ampicillin PMID:27965291 Backbone Marker:Nadav Ahituv lab; Vector Backbone:E1b-GFP-Tol2-Gateway; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-07-25 12:53:33 0
pMIG-W-Flag-Nbs1
 
Resource Report
Resource Website 		RRID:Addgene_89315 Nbs1 Mus musculus Ampicillin PMID:28076792 Flag tagged mNbs1 (2-751aa) Vector Backbone:pMIG-W; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-07-25 12:53:33 0
MIGR1-Meis1a
 
Resource Report
Resource Website 		RRID:Addgene_78148 Meis1a Mus musculus Ampicillin Backbone Marker:Warren Pear, Addgene plasmid 27490; Vector Backbone:MIGR1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-07-25 12:52:04 0
pGEX6p-Meis1a
 
Resource Report
Resource Website 		RRID:Addgene_78144 Meis1a Mus musculus Ampicillin PMID:24578510 Backbone Marker:GE Healthcare; Vector Backbone:pGEX-6p-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:52:04 0
pCAG-cofilin-S3D
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_78297 cofilin 1 Mus musculus Ampicillin PMID:26893343 This plasmid was made by Wei Zhang. Backbone Size:5197; Vector Backbone:pCAG-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S3D 2026-07-25 12:52:05 1
pAAV-CMV-dSa VP64 Neurog2
 
Resource Report
Resource Website 		RRID:Addgene_99695 dCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) Mus musculus Ampicillin Please visit https://doi.org/10.1101/298620 for bioRxiv preprint. Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin dead Cas9 2026-07-25 12:54:19 0
pRosa26-4xInsulator (JP6)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_99627 Gt(Rosa)26Sor Mus musculus Ampicillin PMID:28802047 Vector Backbone:pBlueScript KS II; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin 2026-07-25 12:54:18 1
AAV-KrasWT/sgKras/Cre
 
Resource Report
Resource Website 		RRID:Addgene_99848 Kras Mus musculus Ampicillin PMID:29233960 https://benchling.com/s/seq-GnrunufwzMMMiUzJgwLR Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), Barcode = (AGGCAAGAGCGCCTTGACGATA>AGGCAAGTCGGCACTGACGATA), BsiWI site (CGTGCG>CGTACG) 2026-07-25 12:54:20 0
pCDH-CMV-Tmeff2-3xFlag-EF1-nlsCopGFP
 
Resource Report
Resource Website 		RRID:Addgene_99729 Tmeff2 Mus musculus Ampicillin PMID:28336932 Vector Backbone:pCDH-CMV-MCS-EF1-nlsCopGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:54:20 0
iChr2-Notch Mosaic (SO250)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_99752 HIs-H2B-Cherry, H2B-EGFP-V5, HA-H2B-Cerulean, DN-Maml1, NICD-PEST Mus musculus Ampicillin PMID:28802047 Please note that several discrepancies were found between Addgene's quality control and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function. Vector Backbone:pBlueScript KS; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin 2026-07-25 12:54:20 2
AAV-KrasG12C/sgKras/Cre
 
Resource Report
Resource Website 		RRID:Addgene_99850 Kras Mus musculus Ampicillin PMID:29233960 https://benchling.com/s/seq-Fo9yObwqPPQCG479P7Ll Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), G12C mutation (GGT>TGT), Barcode = (AGGCAAGAGCGCCTTGACGATA>CGGAAAGTCGGCCCTAACAATA), BsiWI site (CGTGCG>CGTACG) 2026-07-25 12:54:20 0
AAV-KrasG12R/sgKras/Cre
 
Resource Report
Resource Website 		RRID:Addgene_99852 Kras Mus musculus Ampicillin PMID:29233960 https://benchling.com/s/seq-ZwWNXX7tP0bisKZNlE3U Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), G12R mutation (GGT>CGT), Barcode = (AGGCAAGAGCGCCTTGACGATA>AGGTAAGTCAGCCCTGACGATT), BsiWI site (CGTGCG>CGTACG) 2026-07-25 12:54:20 0
AAV-KrasG12V/sgKras/Cre
 
Resource Report
Resource Website 		RRID:Addgene_99854 Kras Mus musculus Ampicillin PMID:29233960 https://benchling.com/s/seq-VYuSAajucKlD3iRxltcy Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), G12V mutation (GGT>GTT), Barcode = (AGGCAAGAGCGCCTTGACGATA>CGGGAAATCGGCCCTTACTATT), BsiWI site (CGTGCG>CGTACG) 2026-07-25 12:54:20 0
AAV-KrasG12S/sgKras/Cre
 
Resource Report
Resource Website 		RRID:Addgene_99853 Kras Mus musculus Ampicillin PMID:29233960 https://benchling.com/s/seq-atBNRmhI5tEHkQKLBbHp Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), G12S mutation (GGT>AGT), Barcode = (AGGCAAGAGCGCCTTGACGATA>TGGCAAGTCCGCCCTAACGATC), BsiWI site (CGTGCG>CGTACG) 2026-07-25 12:54:20 0
Icam 2 SaCas9 YAP sgRNA2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_99735 SaCas9 gRNA targeting Yap1 Mus musculus Ampicillin PMID:27926730 Backbone Marker:Feng Zhang Lab; Vector Backbone:pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (Addgene Plasmid #61591); Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-07-25 12:54:19 1
Icam 2 SaCas9 YAP sgRNA1
 
Resource Report
Resource Website 		RRID:Addgene_99734 SaCas9 gRNA targeting Yap1 Mus musculus Ampicillin PMID:27926730 Backbone Marker:Feng Zhang Lab; Vector Backbone:pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (Addgene Plasmid #61591); Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-07-25 12:54:19 0
AAV-KrasG13D/sgKras/Cre
 
Resource Report
Resource Website 		RRID:Addgene_99857 Kras Mus musculus Ampicillin PMID:29233960 https://benchling.com/s/seq-J6bsGpWfPgLvKgL4LbPm Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), G13D mutation (GGC>GAC), Barcode = (AGGCAAGAGCGCCTTGACGATA>GGGTAAGTCAGCGCTGACAATA), BsiWI site (CGTGCG>CGTACG) 2026-07-25 12:54:20 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch