Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,915 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pMyt1(617-736)
 
Resource Report
Resource Website 		RRID:Addgene_22656 myelin Transcription Factor 1 Mus musculus Ampicillin PMID:15935060 Second 1/2 of Myt1 central domain. bp 2380-2739 and aa 617-736. Used for Mammalian 2-hybrid assays This Myt1 DNA cloned by Hudson lab. Backbone Marker:Promega; Backbone Size:6360; Vector Backbone:pBIND; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Second 1/2 of Myt1 central domain (2380-2739 2026-07-25 12:44:35 0
pAdTrack: shRev-Erbalpha
 
Resource Report
Resource Website 		RRID:Addgene_22749 shRev-Erbalpha Mus musculus Kanamycin PMID:20018698 targeting sequence: GCGCTTTGCATCGTTGTTCAA Backbone Marker:Available at Addgene (#16404); Backbone Size:8300; Vector Backbone:pAdTrack; Vector Types:Mammalian Expression, Adenoviral, RNAi; Bacterial Resistance:Kanamycin 2026-07-25 12:44:35 0
pAdTrack-CMV HA ALAS-1
 
Resource Report
Resource Website 		RRID:Addgene_22746 ALAS-1 Mus musculus Kanamycin PMID:20018698 Backbone Marker:Available at Addgene (#16405); Backbone Size:9000; Vector Backbone:pAdTrack-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin 2026-07-25 12:44:35 0
pLKO-1: shALAS-1
 
Resource Report
Resource Website 		RRID:Addgene_22750 shALAS-1 Mus musculus Ampicillin PMID:20018698 targeting sequence: CCAAGATAGTAGCATTTGAAA Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-07-25 12:44:35 0
pMXs-p53S58A
 
Resource Report
Resource Website 		RRID:Addgene_22728 Trp53 Mus musculus Ampicillin PMID:19668191 additional article reference: Cecchinelli, B. et al. Ser58 of mouse p53 is the homologue of human Ser46 and is phosphorylated by HIPK2 in apoptosis. Cell Death Differ. 2006 Nov;13(11):1994-7. Epub 2006 May 26. Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin S58A 2026-07-25 12:44:35 0
pMXs-p53P275S
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22726 Trp53 Mus musculus Ampicillin PMID:19668191 additional article reference: de Vries, A. et al. Targeted point mutations of p53 lead to dominant-negative inhibition of wild-type p53 function. Proc Natl Acad Sci U S A. 2002 Mar 5;99(5):2948-53. Epub 2002 Feb 26. Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin P275S 2026-07-25 12:44:35 1
pCR-5'Myt1outSB605
 
Resource Report
Resource Website 		RRID:Addgene_22738 Myelin Transcription Factor 1 Mus musculus Kanamycin 605bp Myt1 insert can be released with EcoRI. This is the Myt1 5' homology probe. Paper is in preparation. Tentatively titled "The Myelin Transcription Factor 1 (Myt1) is Essential for Neural Development" Backbone Size:3500; Vector Backbone:pCR-Blunt II TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin 2026-07-25 12:44:35 0
pId1-IRES-Venus
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22663 Inhibitor of DNA binding 1 Mus musculus Ampicillin PMID:19896442 This plasmid is identical to Plasmid 22667: pId1-IRES-YFP. Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:35 1
pcDNA3.1-mGAT1
 
Resource Report
Resource Website 		RRID:Addgene_22804 pcDNA3.1-mGAT1 Mus musculus Ampicillin PMID:8757253 Please note that there are a few discrepancies between Addgene's quality control sequence and the author's sequence. The depositing lab is aware of these differences and does not believe they have effect on the function of the plasmid. Backbone Marker:(Invitrogen); Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-07-25 12:44:36 0
pLPC MYC mTel2
 
Resource Report
Resource Website 		RRID:Addgene_22803 Telomere Maintenance 2 Mus musculus Ampicillin PMID:18160036 Backbone Size:5600; Vector Backbone:pLPC-N MYC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-07-25 12:44:36 0
pME18S-3HA-mULK2(K39T)
 
Resource Report
Resource Website 		RRID:Addgene_22899 UNC-51-like kinase 2 Mus musculus Ampicillin PMID:10557072 Backbone Size:3400; Vector Backbone:pME18s; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin changed Lysine 39 to Threonine 2026-07-25 12:44:37 0
pME18S-3HA-mULK1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22896 a novel protein kinase structurally related to C. elegans UNC-51 Mus musculus Ampicillin PMID:9600096 Backbone Size:3410; Vector Backbone:pME18s; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:36 1
pME18S-3HA-mULK2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22898 UNC-51-like kinase 2 Mus musculus Ampicillin PMID:10557072 Backbone Size:3400; Vector Backbone:pME18s; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:36 1
pAAV-mCAMK-RFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22908 mouse alpha-calcium/calmodulin-dependent protein kinase II promoter Mus musculus Ampicillin PMID:19318117 Please note- this plasmid contains the mouse α-calcium/calmodulin-dependent protein kinase II promoter (mCAMK). There are several mismatches between depositor's sequence and Addgene's sequence. Please refer to Addgene's results for the correct sequence. Backbone Size:4000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-07-25 12:44:37 3
pCS2+FOG2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22868 FOG2 Mus musculus Ampicillin This plasmid was cloned by Sergei Tevosian in Dr. Stuart Orkin's Laboratory Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:36 1
pCI-neo-mAtg12
 
Resource Report
Resource Website 		RRID:Addgene_22870 autophagy-related genes 12 Mus musculus Ampicillin PMID:12482611 Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:36 0
pAAV-mA93-RFP
 
Resource Report
Resource Website 		RRID:Addgene_22918 mouse riken gene A930038C07Rik promoter driving DsRedExpress Mus musculus Ampicillin PMID:19949461 Addgene quality control sequence detected a 2bp gap in the promoter region in BLAST. In addition there's a small gap in the vector region between dsRed and bGlob intron. These changes should not affect plasmid function. Backbone Size:4000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-07-25 12:44:37 0
Myc-ND2 (N72)
 
Resource Report
Resource Website 		RRID:Addgene_22966 NeuroD2 Mus musculus Ampicillin Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:37 0
Myc-G4-ND2 (N67)
 
Resource Report
Resource Website 		RRID:Addgene_22967 NeuroD2 Mus musculus Ampicillin Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:37 0
pcDNA FLAG TORC2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22975 TORC2 Mus musculus Ampicillin PMID:14536081 EcoRI/NotI cloning sites. Not I cloning site was added to pcDNA 3.0 MCS. Contains stop codon in cDNA sequence. Backbone Size:5000; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:37 3

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch