Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: myelin Transcription Factor 1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6360; Vector Backbone:pBIND; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Second 1/2 of Myt1 central domain. bp 2380-2739 and aa 617-736. Used for Mammalian 2-hybrid assays
This Myt1 DNA cloned by Hudson lab.
Proper citation: RRID:Addgene_22656 Copy
Species: Mus musculus
Genetic Insert: shRev-Erbalpha
Vector Backbone Description: Backbone Marker:Available at Addgene (#16404); Backbone Size:8300; Vector Backbone:pAdTrack; Vector Types:Mammalian Expression, Adenoviral, RNAi; Bacterial Resistance:Kanamycin
References:
Comments: targeting sequence: GCGCTTTGCATCGTTGTTCAA
Proper citation: RRID:Addgene_22749 Copy
Species: Mus musculus
Genetic Insert: ALAS-1
Vector Backbone Description: Backbone Marker:Available at Addgene (#16405); Backbone Size:9000; Vector Backbone:pAdTrack-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_22746 Copy
Species: Mus musculus
Genetic Insert: shALAS-1
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: targeting sequence: CCAAGATAGTAGCATTTGAAA
Proper citation: RRID:Addgene_22750 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: additional article reference: Cecchinelli, B. et al. Ser58 of mouse p53 is the homologue of human Ser46 and is phosphorylated by HIPK2 in apoptosis. Cell Death Differ. 2006 Nov;13(11):1994-7. Epub 2006 May 26.
Proper citation: RRID:Addgene_22728 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: additional article reference: de Vries, A. et al. Targeted point mutations of p53 lead to dominant-negative inhibition of wild-type p53 function. Proc Natl Acad Sci U S A. 2002 Mar 5;99(5):2948-53. Epub 2002 Feb 26.
Proper citation: RRID:Addgene_22726 Copy
Species: Mus musculus
Genetic Insert: Myelin Transcription Factor 1
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pCR-Blunt II TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin
References:
Comments: 605bp Myt1 insert can be released with EcoRI. This is the Myt1 5' homology probe. Paper is in preparation. Tentatively titled "The Myelin Transcription Factor 1 (Myt1) is Essential for Neural Development"
Proper citation: RRID:Addgene_22738 Copy
Species: Mus musculus
Genetic Insert: Inhibitor of DNA binding 1
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid is identical to Plasmid 22667: pId1-IRES-YFP.
Proper citation: RRID:Addgene_22663 Copy
Species: Mus musculus
Genetic Insert: pcDNA3.1-mGAT1
Vector Backbone Description: Backbone Marker:(Invitrogen); Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note that there are a few discrepancies between Addgene's quality control sequence and the author's sequence. The depositing lab is aware of these differences and does not believe they have effect on the function of the plasmid.
Proper citation: RRID:Addgene_22804 Copy
Species: Mus musculus
Genetic Insert: Telomere Maintenance 2
Vector Backbone Description: Backbone Size:5600; Vector Backbone:pLPC-N MYC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22803 Copy
Species: Mus musculus
Genetic Insert: UNC-51-like kinase 2
Vector Backbone Description: Backbone Size:3400; Vector Backbone:pME18s; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22899 Copy
Species: Mus musculus
Genetic Insert: a novel protein kinase structurally related to C. elegans UNC-51
Vector Backbone Description: Backbone Size:3410; Vector Backbone:pME18s; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22896 Copy
Species: Mus musculus
Genetic Insert: UNC-51-like kinase 2
Vector Backbone Description: Backbone Size:3400; Vector Backbone:pME18s; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22898 Copy
Species: Mus musculus
Genetic Insert: mouse alpha-calcium/calmodulin-dependent protein kinase II promoter
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments: Please note- this plasmid contains the mouse α-calcium/calmodulin-dependent protein kinase II promoter (mCAMK). There are several mismatches between depositor's sequence and Addgene's sequence. Please refer to Addgene's results for the correct sequence.
Proper citation: RRID:Addgene_22908 Copy
Species: Mus musculus
Genetic Insert: FOG2
Vector Backbone Description: Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid was cloned by Sergei Tevosian in Dr. Stuart Orkin's Laboratory
Proper citation: RRID:Addgene_22868 Copy
Species: Mus musculus
Genetic Insert: autophagy-related genes 12
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22870 Copy
Species: Mus musculus
Genetic Insert: mouse riken gene A930038C07Rik promoter driving DsRedExpress
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments: Addgene quality control sequence detected a 2bp gap in the promoter region in BLAST. In addition there's a small gap in the vector region between dsRed and bGlob intron. These changes should not affect plasmid function.
Proper citation: RRID:Addgene_22918 Copy
Species: Mus musculus
Genetic Insert: NeuroD2
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22966 Copy
Species: Mus musculus
Genetic Insert: NeuroD2
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22967 Copy
Species: Mus musculus
Genetic Insert: TORC2
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: EcoRI/NotI cloning sites. Not I cloning site was added to pcDNA 3.0 MCS. Contains stop codon in cDNA sequence.
Proper citation: RRID:Addgene_22975 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
